Description :
From Genome Similarity Track
Location :
Scaffold_266:24507- 25904
Sequence
1397 bases(100 bases per row)
ATTTTTTTTCGTTGTAGGCTATCAGGGTTAAGACCATTCAGGAAGGAGCGAAACAACAAAAGTTCAATTTGAAGGACTTTCTtaaaagaaaaaaaataca
atAACCAGTATTCTGAGTTTTTCCTAGCGGAATCGTTATTCGAGTGTTTATTTCCTAGCTAAGTTGGAAGTTCCAACTTGGAACAGTAACACAAATATAT
TTCACGAAACAAACACAGCTATTTTTTCATCTCTTGTGGCAGGGGGTTACTGGAGCGTTAATACTAGATAATTTTTTGTCTTTGTGGTACTGGTTGGTTA
TTTTTAAGCACGCGGAATCCAAAATACGGTTCTTTTTGACCGGATTTAACGGCAGCGGATAAAATGTAAGTAACTTAATTACTTTGAAGCACACCCGTTG
CGACGGCATCGGACGTCTTGCTCTACTGCATCCACTTAAAGTGTACTAAGTAGAACATCTGAACTGTATTCTTTGCGCTCAAAGATATCTCGTTTTGTTT
GATTCCAAACCGTAAATGatttctacatgtagtattcGGGCAATGTTCTCGAGAGCTTAATCTGCGCAGGCATAGCTGGAACCCATTAAAAAGTGGTTAA
AGTACATAGCTCATCAAGCAGCCAAGCACCGAAAATTTGTCAAAAAAATAACAAAAAGAATACTTTTGGATTATTCTGTTTCAAAGTAAATAATCGCCTC
AAAACTGTTAAGGAAGCTGAACGAAGAGATCCACCACGATAAATCCACGCGTCCCACGTGAAAAAGCATGCCTTGGATGGATTATTTTCGAAGCTAATCC
GAAAATCCATGGTAATTAAAAGTCCTTGTGACAGTTGCCGTATTGTTAATGAAGTCTTTACCGTGGGCTCAACCGGCACGGAGAAGGCATGGTGGTCAGT
CAGCCTGGCTGGAAATGTGTGATATGAGCGCCCAGGTTCTTTCATCCTCTATTTTTCACTTTTCCTATAGCGAGTGGCCATCTTGCGCTTCCGCTTGGCT
GCGATAACACACTTCTGTTTGGCTTTTCCgtgtggaagcagcagtgtaTTGAATCAACAATAGTATTGATTGCTTCGACGGCAGGTAAGACTTGGAGCCA
GTGGCTCGGAGCCACAGACTGGCTGTCGAGCACTTCAGGATTTACtctcaaggacgaggagtacAAGAACTAAAGCTTCGTCATAGTATACTACAAACTT
CAACGCGTTAAAAGGGTCATCTTCTTTAGTAACTTAGAAGTAGTGCCGATCAATTATTACCAGTCCggtaaagaagaagaaaaaaaatgaatCGAGCCCA
TTGAAATTTTGAGTAATTTCTATTATACTTCGTATTCTACAGTACTACTTCTTTAAGTATTCAAGAAATCAAGATCAAACTCACAAGTGATGCTCAT