Description :
From Genome Similarity Track
Location :
Scaffold_283:24505- 26168
Sequence
1663 bases(100 bases per row)
CAGCAAATGGGGTTCCTACATCACGTCATCACACATCAGGAGTCTACCAGCAAGTCCAAGAGTTTGCTTTCATGTGCTTGGCTGACTCTTACAATCGACT
AATCTTTTGCGACAAAGTGTAGCGCTTTGTCTGCAAATCTTTTACGTAATATGTGACTATCTGATCAGCTGACGATTGTGAAACCCGATTCAATGTAAGT
GCAACCTCTCAGGCCTGGTCAAAGGTGTGAAGTTTTGTGCTGCGTTGAACCTTGCAATTTATCAGTAGACATTCCAAATCACTGACTTTATATTACAAAG
TTGAGCTTCTCAATTGTATAAGGCCGTCCACTTGGGAAACTTGAATCGATTTTATGATCGATGGATCCGCGTTGTGCTGCTTCTTGGGGCTATTAGCTTA
CTCGCAAGGTACGAGTTCGATTGTTTCAAAGCATCTTCTGCGTTGTGGTCTCCTTTACAGATGAAAAGCTGATTCATGGGATCAACCTGGACGTTCTTAT
TTCCTCATAGGTTGAATACCATTTTTAGACATATCACTCGTAAATTCGTCGGTAAACGTGCTGTCCTGAATATTGAGCGTAAATCTAGATTCACGCGAAG
CTATTTAAATTTGATCCGTGGTCGCAAAGTCGTATCTGTGATTAAAGAAATGAGAATTCGAATGAAAGTAGTGAGTTATTGCGCTTTACCCCAGTCTGTT
CCTCCAAAGCAATTTCTCAAGGAATGGTACGAACACTTCTTTCCTAAAAGTCTTGACTAATGATATGCGCCTTCGACTTGAATCAAAGGACATACAACTC
CTGGGCTGTACCCTGTCGTCCTCATATGAAACCTTCATGGCCAGCTAACTTTCAACGCATTTGCTCTAGTTGACCTGACCCAAAGACAAAACATGATGAC
TTGGCACTTTTAACTATTCATTAGAACAGAGTGGGAAGCAAATTGTTGGTCTCGAGTCGTGAGAAGGTCAAATCGATGACAGCGCCTTGGCACATTCATG
CTTTTTATGCTTCAGAAGCTTGTCACTATTTCTATTTGCTCGAAAATGTGACTTTTGCATCCGTTAGGATAGGCACCTGATGCTGCGGGTGATGGGCTCG
GTCTCCATAACAAAGGTTAGGCATCGGAGATCGCGTGTATCTTTCCACCAAGACGGGTTCGAGAGCAACTTGAATACTACACTTTTACAATTGCAGTTAT
AGGAGTCGAGCAACCCCGAAGCTGTTGTAGTAGAGAAGATTTGTTCAAGAAGGAGCGAAACATCAAAATTAACTTTAGTTTATTACTTGTTTTCTTTAGA
ATAAGTTTGAAAAAAATTGGTACTTGTGGAGACCATGAGTATATACAACGGAAGACATGTACGAGGAGCTAAGACGAATCTTACCCGATGCGGAGGGAGT
GCGACAAAGACGCACATTGCGTAGACTCGACCCGTCTGGAACTTTCTTTGGAGAGCTGACCGAGAACGTGTTCGAAGCATGAAAGAAGACATAGAAATGA
CGGATCTTTCCGGAGACAGTCGGATAGCAAACGCACCTCAGCTTCCACGACACCCTATTTACAAAGGGGAAACGTCCAACGACAAGCGCGAATTCGCCAA
ATAATACCAAAGGTATTACAACACGCTGCTGGCCTATGAGACGTGCACGAACAAGCCGTTTGT