Description :
From Genome Similarity Track
Location :
Scaffold_81:24502- 27188
Transcript NameFunction/comments
g14480.t1hypothetical protein

Sequence
2686 bases(100 bases per row)
GGCGATCTATCCCAGCTTTCTGAAGCCAAGGATCAAATCGAATCAGAGCGAGCTTCTGCTATGCAAGATATTGAGCGACTTCAGGGCGATATGGAAAAGC
TTCAAGATGAGAAGGACGCAATGGCAAGTGAGATTGTGGTTTTGTCGGAGCGTGCTGGGCAGTTGTCAGTCCAGACGAGCGAGATCGAAACCCAAAATGC
TGAGCTAGTGAAGAGATGTGAAGAGCAACAAGCCCAGCTGTCCGAATCGGAAGGCACCATCAAGAAGTTCGCCCAAGAAGTAAAGGAACTTCAGCAGCAA
GTTGCAACTCAGTCAAACAAAGCCGTAGAGCTTCAAAAGGATCTCTCCTCGGCACAGGAAGATGCTCGCCAAGCTGCTATTGCACAGTCTAAACAACTTG
AGGGGCTGGCTACTAGTGCAACGAAGATTGAAGAACTGAAGCAGGAGCTTGCTGGAAACGAGGATTCAATGAATGAGTTGTCTAGCAAGCTTGACAAGGC
CGTAAGCGAGGTTCGTGACGCTGAAGATGCTGCTTCTCGTCAGCGGGCGGAGATAAAGATGTACAAGGGGATCCAATCGACCCTGCGCGATGAAGTGCGC
AAACTTGAGTTTGATCGTCTGGAGCTAGCTGAATCTCTGAAGACCGAGCAAGAGTCAAAGCCGGATGCGGAACTAAAGTTTGCTGTGGCTCGAGACACAT
GGATGGACGAGAAGAACAAGCTCATGCAACTTTATCAAGAATCGATCTCGGCTGTTGATAAACGTGTTGAGGAGCTGACACTCAACGGGGAAACTTTGTC
AGCTCAGAATCGCGAGCTGGAGCAAGAGAATGACAGTCTAAAGGCATCGGTTGTTGAAAAGGATAGAAATCTACGAGAACTGAAGGATCGTGTTGCCGAG
CAGGAAGACAAGGTCTGTTCGCTTGAGTCGGGTACCGCTGACTCAGTTGCAACACAAGTCCAGTTGACTGACACCGTCACCGAGCTGCGGAACAGCCTAC
ACGATCTTGAACAGCAGTTGGCGGAGCAGCAGAGCACTGCGTCAAATCGGGAGGCGGAGCTGTCTGAGAAGATGACCGCCATTTCGGACAGGGATAACAC
CATTAACTCGCTGAATGAGCGTTTGCAGAGCGATGAAGCTGCGTGGAATCTGAAGACCCGTGAGTACAAAGCTGAGTTGGAGACTGTCCATGGTCGAGTG
CAAGCGTTTGAGCAGTTGGTTGCGGAGAAGACTGCCGTGTTCGCAAAGGCTGAAGAGACATTCTTGACGGAGAAGTGCTCACTCGAGCAGAAGGTAACAG
AAGGAGAGGAAATATTGGCGCAACACACGGAGCAACTGATGCAGGAGATCAAGCAGCTCGGCTCCTCCATCGAGGAGAAGGACATGCAGCTCGAGGTTGC
GAACAAATCGTTAGTTGAGGTGGAGGAACGTTTGGCACGCTCTGTCGAGGATGACAGCAGCGCCAAGGTGAAAGAACTTCATGCTGCGATGGAAGAGCTC
GACGTTAAGTACAAATTGGTTGTGGCTGAGAACGTGAGTCTCAAGAAGAAGACAGTATCTGAGCTGAAGGCGCAGGAAGAGGAGATCAACCGCCGCCGGA
GTGAACTTGACGCTGCCGAGGAGCAGATCATATCCGACCGAAAGGTATTGGAAGAGCAGAAAGCAGCAGCTCTTGCAGCTGAGACTGCCCAGAAGGAAGC
CAAAGCAAAGGCCGTAGCTCAAGATACCGTTGGACAGCTGAAGCGCAAATTCTTGACAGACAAGGTGAAGATGCAGCGCGAGATCCAGTCGCTAACCAAG
AAGCTGGAGATGGTGACGAAAGAGAACGAGAAGCTTGTTGGCCACCACAACAGCCGCCAGAAGATTCAACACCACGTGAAGGTGAAGGAGGAGAACAACC
GTCTTCTGGACCAGGTGCGGCAGCTGACGGACGAAAGGTGCAAACTGCAGCGCTCGCTGGAGAAGCTGCGCTCTACACTCAAGGAGAAGGAGAATGTTGG
TGTGCATTCGACCAACAATACGCCGTCATCGGTGTCGCCTGCGTCGAGCGCATCCAGCCAGACACAAGTCACCAAGAAGGTCCGGCAATCGAGTCTGGGT
AGTGTATCAAACGCAACAGCAGGAACTGCCGCCTCTCAAGCAAGGACAGCAGCCAGGTTAGCAGCGCGAGGCCGACCCATGAGTCGGTCAGCATCCCCAG
GGCCGACCAAGAAGCGGGCACGGACACCAAGTTCGGCGGTGCCGGGCTGGCAGAGATAGCTGCAAGTCCCGCTTCATGGTGCACCATCCCAGTATGCGTA
ACGACTCGAGTGGATGGATTAGATGTAGACAAAGGAGTAATGCAGGTGCAGTTCATTTATTACGACCCGCTGTGAGTATCGATGTCGTCTTTGCTCGATG
TCGCGAAGGCGATGAACGCCGAGGCAGCCAGTGCTGCTGCGATGCTGTCGCTTGCTGACGTTGCCAGAGCTGAAAACGCTGTGAATGGTTCGTCCAAGCC
CATGACTCTGCTAGACGTGGCCAAGCAGGAGCCACAGCCACCAAAGCAAACACTGCAGCAGTTAGCTCAAGAGATCAACAAGGAAGATCGATCAAGGATT
CAGGCGGCACTGGAGTCCACAGCGAAGGGGGTGAAGACGGAGCCTCAGGAACTCCGCTCACAGGCCTTGAAGCAATCAGCGGCGGA