Description :
From Genome Similarity Track
Location :
Scaffold_35:245007- 250418
Sequence
5411 bases(100 bases per row)
TCGATGCTTCTCCTAATCTACATTGCGGTTCGCGTTAAGCTTCAAGAGGGCAGACTTTAAGATCGGAATATCTTGCAGACGTCTTTCTTGATCGGCTAGT
TCTCGGCGACCTTCTGCTCGGCATCTTCCAACTTGTTACGCAGATTGTTAGTACGCTATTTCACAAATTGCCTGATCGGTTCAGCGAAGTTTTGAACTTC
ATGTAGTTGGCGTTCCAAGCGATTTTCACGAAGTTCTTGAGCTCTTAATTGGTCTTGGATTGCCCTGTAATCGTCCAACACGTCTTGAAGGGACTCAGCA
AAATCGTAGAGATCATCTATGTACGATCGCAATGTGCATCGATCGACCGCAGGGAGGAAGTTCATCCGGCCACTTGGAAAAGATGCAAAATAATGCAGTG
GGGTTACGGCTGGCGGTGGAGAACTTGGTATGTCGGACGGGCCCGGGCAGGAGTCGACAGATCATCGGATCCCTCTATGTAGTCGATACAGGTGAACATG
GAGCTGCAGAAGTAGAGCAGACGGATGACGAAGTGCACCGATACACCAGCACTGTATGCCGGTTATTAGAGCAGGGGACGGCTGTGGTGGAGCGGTGTGA
AGAAATTCGAAGTGATCGATGGGTGGACTGATCGAAAACGACGACTGATCGTCGAGAAGGATCGATTGGCTTTCAAGCTGCACAATATTGAGATCGAATA
TCAAGATCGATTATCAAGATACCAGGATAGAGAATATATAGGTTGATCAAGGTTGAGAATATGATCGGAGATCGAGGGTGATCGACGAGCGATTAAGGTG
ATCGACGATCAATCAAGGTGATTGACGATCGATTATCAACGATCAATCAAAGTGATCGACAATCAATGAAGGTGATCGACGATCAATCAAGGTGATCGAT
AGTCGATTAGGACTGGACCACGTATGCGAAGTAACGATCGACGGAATGCAGAAGACACATGGCAGCATACCCTGGTATACAGACAGGCACAATGGTAGGT
TTAGCTTTTAATTTGTGAACATTAAATAGAATTCTATTTGCTTCTAAGTACACGTGTTGACTTCTCTTCCGGGCTGGATTTTTGGCCTCCCGACGTCAAG
AGAGTCTCACATACTGAAACCAAGTGTAATTGGCTGGGGATCAAGAATTCTCAAGACAACCCCAACTGCGAATGGACGCAGCAAGAACGTACAGGACTAG
GTACATTATCACAAGACGGCTCAAGTGATCAGAATGCTCGCGTTTCAAGCATCTACATATTGGACAAGACCATCTCGTTGAGATCTGGGTGACTTACATC
AATTACCCTACTAGTACACCCGTGATTGTGTGAAGATTTCCGCACGATCGCACCAACCCATCCCCAACACGGTCACTTTTTCCCTCGACACGGGTCCACC
GAAAAGAGTGCAACCCGCCCTACCGACGGGTACACAAGGTGATAAAGGAACAAGTGCAAGCGGTATCGGAGTACCCCCTCCGTTAGTCGGTCGTCTGGGT
GCCAGTGGAGAGTTAGGATCGCCTCATAAAATGAGCTATCGCCACTCCCTCAAACTAAACTAAATCTGCAGTTCATATTTCTTCACAAGATAATATCAAT
GAAATGATGGGTATAACTTTGGATATAATGAATTCTGTGTCGTTTAAGCAACCACACGATACTCGATGTATGTTGTTGCCTAATCCTGGATGAAAATGTC
GGTACTCGATTATGTCTGGTGATCGAAAGATGCTTATCATGTCGGCGACGCTTTTGACATGGTCAGTCTACACGGGTATACAATAGCACTACACTTATTC
CATAGGTCCTTACGAACCGCTCGAGATGCTTACTGCTGCACTGTCGCCGCAGCTACCCCGTGTGTTAAGGTGTACGGTATGTATTCAAGACGACTTTCAG
CCCGTATAAATGGCTAGCGTGACCATCGAAGCGTCCCAGCTCGGCGATGACGCGCGGCCGGCCGTGATATATACAATCAGTCGACCTAAACATTTACACG
ATACTAAAGTCATTCCTGTTTTTCCAACATGCCAATCATTTGAATTAAGAACCGTACCGATAACTTGGCGCATGAGTATGGTCTCACAATTGTACCAACT
TCGGCTCCGGTATGTTTGAATCGAATAACGCATGATTTAAGGTTTGATTGTCCACTAATGTCGCACAGTCGCACATTACGGTTGTCATTATTAAAGTAAA
AATCATACAACAGTTTGATCGCTTACCGTTTTTTGTTAAGCTTTGCTCCCTCCTGACCTTCCTTCCACATAACTGTGCGAACGCGAGAGAGATCTACACA
AGACATCCCACACACAATTCGAGGTCTAGCGAGGGGGGATTTTCGCCAAAGGTGGGTGCCACTGAGAGAGGAAAAGGGGCGGACCGTCTTGAGTGACTAC
TGCAGACATTGAAGAATAGAAGAATACAAATACGGAAGGATTTAGCGTGGTATAAATTAATTTCATTCTGAAATGGTGCTGGGTATGCGACTGGTGCCGC
ATTTGCAATGTTTGTCTCCGGCTTGCGCTATTTTTTTGCATTTCTCCTTCTTTATGTCTAGTGTAAACGGTCGATCTGTCCGCGATCTGCAAAGCTTATA
TCCGTTTATCTTCTTCATACTTCTTCATGGATGTTTTATACATCAGAATACAGCTGTCCATATTAAAGTTGGGGTCATTTCCTACGTCGTGATCGCATTC
GTCGATCGCATTTCTGTATCGATCAGGTCCATTATTCCAATCAGTAGTGCTGGATCAGACGTTCCTAGCAACAATTGTTGGATGTAGGTCAAATCTACTG
AATTTATCTCTTATTCTGCTGAAACCTACTGAGATAATCCCGTATGGTATCCGCTCTTAATATCGGTGTTCGGTGCGATATCTTGATCCGTATGACCTAA
TTTCTCGAACGCGAGGAAATAACCTCCCGAATAGCTATCGTCTTAGGTTTTTTACTCGATCTTGATCGAAAACATCATCATCTGCGCTTCAACACCGCTC
TAGTTAAGTCTAACCTCTTCAAGCAACTTTACAAGACGACGGATCGCTTCCAACTGGTTCGAAATACCTTTAGAAGCTGAAACAAGTCCCCGCACCGATC
CAACTATCTTTGATTTCGAAATCCTCACAACGAAATCATTGGACAGCAACATCGGTAGCAACTTTCAATAAAAACACTGATCATGTTTAATCATTCGTGA
TTCTTCAAGAATTGATTCCAGACCATCTAATTGTTTCTTAGCGTAGCGATCAGCGCCAGAAATCTTTAGTTTCGATCACGATTGCTTTATATCATTCTTA
TTCGACTTGACTAGAGTAATTTATAAACAAATACCTCGATATTAGTGCAATATATTCATCCATCTAATCTCACTTTGCATCACATTCCATAATGGTCTCC
ATAAAGATCGCAGGTGAGGTTTGAGGTTCATCTTCTAAATCTAGCGATAAGTATTCCTCTTGATTTTTATTTATCAAAGCCCCTTCAAAAATATGAGATC
ACAAAATTTGTTATCGTCACGCGTCTGAGACGATATCTCTTCCACCGATACTTAAAATCCCAGGTTTTATCGTGACCTTGACATCTGTTTACTTTACTCT
GATACTTACGGTGAATTCTATAGTGATTAGAAGATCCGGAAGAGCGCACGATCGTGGTATAATGGGATTCACAATATTGCTGATGTGATCCCGACCCTCC
AATGGCGCCCAGAAACCCGACTATAAGAGGGAGTAATCCGTTTCTTTGCTTTGTTCTTCCTTCCTCATATTGCATGACCGCCGATATGGCAGGTTGAACT
CTTTATCGTGGGTCAATTCGATGCTGAACCTGATCAATTTCGGGATTGGTTTGAGAGCCGATCGAGCAGAAATATTCAATTGATCGCTTTGGTCTGGGGG
GCGCTCTACTTGAGTCACCCTGATAACTTTTAAGATCGCCTTGTCCATAGTTGATACTTGAAACACTTGCCTCCTGATCACTTGAACCGTTTCGCGATCA
TTTATCTGAACCACTTGTGTTTTTATGCGCTCAATCGCAATTAGGGGTATGTATTAAAAGTTCTTGTTGTGTCTGGCCAAAGACGCTAGAGGCGAAAGTG
GGATACGTAGGTATCTGTTCTTAAATGTGGAGGCCAAAAATATCCAACCCGGGAGAAAAAGACACGTGTATTTAGAAGTAAATTGAGTTCGGTCAATAAT
AACCGACAAGTGATTGAAGATGTAACTGTTGTTATTCCCTATGTCAAGAGAGACTGACATGCGCATACAGTGCTTTTAGGATGGGCCACGTTATTGTGGG
TGGACCACTCATTGTTCGTAATCATCGATGAGATTATAAAACTTAAGCAATCCGCAATCCAATGAATAAAATCAACGCAATTTGTGACCAAGTGATCGAG
CTAAATCGATCTTTTGATCCACATTTCTAACCTGATCACAACCTTGATTTAATCGCGATTGAATTAATACTATCCAAAGAAATGGTATTCGCAAAGGGTT
GGAGATAGTTGAGAGGACCGTCTTATGCGACATGCATACGAGAAGGTTCCGATTGTACACGAAAGGAAAATGTTTATAATGAAGGCGAACGTCCACGATC
GTGGGTATGAGCCCACAAGGCAGAATGGCGACAGCTGAATGAGCGAAGGGTTTTTAGAGTAGATTGCATTGATGGCATGGTCCACATCGTGATCAAGCGA
CGCATCAAGAATCCCGATAACAGAATGAGATCAAGAACCGTGATCAGGCAGCACGATCAGGCATGGAACCCACATCGAAAGAAACCGCATACTGCCATCA
ATCATTGAGATCAAGGACTTTAATCTGACGTGAATGTTCTGATGAATTGAAAAAAAAAACCTAATTGCACTTTATGCGCATGTCAGTCTCTCTTGACATA
GGGAATAACAACAGTTACATCTTCAATCACTTGTCGGTTATTATTGACCGAACTCAATTTACTTCTAAATACACGTGTCTTTTTCTCCCGGGTTGGATAT
TTTTGGCCTCCACATTTAAGAACAGATACCTACGTATCCCACTTTCGCCTCTAGCGTCTTTGGCCAGACACAACAAGAACTTTTAATACATACCCCTAAT
TGCGATTGAGCGCATAAAAACACAAGTGGTTCAGATAAATGATCGCGAAACGGTTCAAGTGATCAGGAGGCAAGTGTTTCAAGTATCAACTATGGACAAG
GCGATCTTAAAAGTTATCAGGGTGACTCAAGTAGAGCGCCCCCCAGACCAAAGCGATCAATTGAATATTTCTGCTCGATCGGCTCTCAAACCAATCCCGA
AATTGATCAGGTTCAGCATCGAATTGACCCACGATAAAGAGTTCAACCTGCCATATCGGCGGTCATGCAATATGAGGAAGGAAGAACAAAGCAAAGAAAC
GGATTACTCCC