Description :
From Genome Similarity Track
Location :
Scaffold_1011:2450- 7285
Transcript NameFunction/comments
g17626.t1hypothetical protein

Sequence
4835 bases(100 bases per row)
CTAAGAGGCGACGGTTGGGACGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGG
TGGAGGGGGCGTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCA
GTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCGCAGCGAGCGCGATCCAGACGAAGTAACATGACCGACTCTCAGCGGGA
GAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAGCGAAACCGGATCGCACAG
CAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCTGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCACTG
AAGAGCGCAGAACAGATCGTGAGCAACACGCGGAGCGCCGGTCTCAGCTCACGCAGGAGGAGCGTACCGAAGAACGGTTGGTAAATCAAGAGCAACACGC
GGAGCGCAGATCACATCTCACACAGGAGGAGCGTGCCGAGGAGCGGATAGTAAACCAAGAGCAACATGCCCAGCGCCGATCTCAGCTTACGCAGGAGGAG
CGTGCTGAAGCGCGAAGGGTAAACCAAGAGCAACACGCGGAGCGTAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGCGC
AACATGCCCAGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATTGTAAACCAAGAGCAACACGCGGAACGCCGCAGAGAACAGACCGA
GGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCCTAC
GTCCAGGGTCCAGACGCTGTGAATGGGCACCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCAAAAACGA
GCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACGTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGCACATACG
AGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGGACAGAGG
GGCGTGTACACGTATCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCGCTACTCCCCTATATTGATCCCGCCACTGGAGAGCGCACGGACCCTAAGT
TCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGGACATTGA
GCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATATGGTGTTC
CGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGATAGGCCTC
GCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTACCCTCTTCTGCTTCCGTATGG
GGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGGTTGCAC
CAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAACTTCGCT
GGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACAGAGGGCTTCAGGACGCACTGCTGAACGAAGGTACAATTCAGCTGGAAGCAGGCGAAGG
GCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACGCCGCGTT
ATTCTGCCCTCATCTCATATGGGCAGTCCTCGCGCAATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGTGTTCA
TGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGTGTCTG
GCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAGGGCTC
CCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGACAGAGAAA
AGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAGTGTAC
GAAAGGATACCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGGCGAGCTGAAGGCGTCCTGGTATGG
AAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAGGTGT
GCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTGGAGAGCT
CCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCAAGGA
AAGACACACGCAGTCACTCAGCTTACCGTTCACGTTGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTGGTCGTGGGAA
TCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGGAATTC
CGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGAGCGCTTCT
ATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGACGCGGCTGA
ACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCTTTGCAACA
ATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCCTACAGGAACCGAGAGATGTTGG
ACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTACTCCGTCCAAGACTTTGATCTCCCTCG
GCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAAATT
GTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCTTCG
TTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTCGCTTCCAGTGG
GATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCATTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAGCGA
TCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGATAGAACGCTTC
GTGATGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAGATTCTCCCCGTGGTGAAGGGCGGCTCGGC
GACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACC
TCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGGAGGTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGACTACATTA
AGATTCCACGCGAGATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGAT
CGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGT
ATCAACGAAGCCGTAGCGGATCGCATGACTGGGCC