Description :
From Genome Similarity Track
Location :
Scaffold_1200:2450- 3776
Transcript NameFunction/comments
Phyta_totarag12386hypothetical protein

Sequence
1326 bases(100 bases per row)
AGAGAATGTAGCCAAGTTAGCGGAGGACGCGGACCATCTATCCCGCGGTCCGGGCACGCGGCACCCTCACTGAGGGCTTCTCACTTTCAATTCAGCATCC
AAGGCGACACCACCAAGAGCGCGGCGTGCCACTGCCGCGGCAAGACTGGCTCGGCGGCGCCGACTGGTTCGACAGACAACACTATTGCGGCGCGACGTGG
CTCGGCCGGCCCGAAGGTTCCGCGGACACAGTCAAAATGAAGGTCGCGACGTGCCTCGGCGGGCACGAAGGCTGGCACGGTGGCGTCAGGGCTatgcagt
tgcagcgcagCTTGTGTGGAGCGTGTTGCCGGGCTTTTACTTGACCCGTACCGCTCTGGCTGATTGCTGCGTAGCAACCGCGAAGCTGATGTACGCTGGC
GGCTTGGTGAGGATGGACGTGACGGCGGGCTTAGCTTAGGAATTGTATGAGCTGTAAACATTGTTCATAAATTAAATGAAATTACCCTTAAGCTGTGTTG
TGCCTTCACCAGCCTCCGCCTCAATGTACGCGCGCTCAACTTGGTGGCGCTTACGCTTCCGGTACTTCTTAATCTTGTTAAAAGGAAAGTTTGCTACTGG
CTCCCATGTTGGTTCCCACGAAGTTAGAAATAGCACGCGCCCATTAACAAGCTGGTCGTCCAGAATGGTGCGCATCAAGTAGGTAGGAAGGCCGCACAAG
TCGACCCCGGCCGGCAGCACCCATTCCGCCTcaccagcgtcgtcgccttgcgcagctgcttcaatgAGACGAGCCTTTGTGATTCGGGCGTTTGACACTG
CGTCGAGCAGCCGCTTGGTTGTCTCGTCGATGTTTACGGCGGCGTCTCGATGGACGTGGCCCCACGTCCTCAAATAGCGCGCCGCTGCCTCATCAAGCCG
GTCCCACCCTCGCTCACGTAGGTACAACTTGCACCAATCGATGAACACGTAAAACGAGGTGGGCGGTGCAGCGGcgtcgttggtggtgactAGTGGGCTT
GACAATTTGGGGGAAGTTGATGAAGTGAGTCTGTACGCAGCTTGTGGCCGTCGGCTCCGTTGGTTTCACTTTTGTAGGTTACCTGTGCCTACTCATATAG
CGATTAATATCGTGGAAATGTGTCCGAGGACGTCCAGCTGGAACTCGAGTACTCGACGTACGCGCTTGGCGTCGCTTTCTAGGCACCGAACGGTTGACGA
GCGTCCGCTTGCCGTCAAGCCCAGTGTAGTGCTTGACCTGTGGCGCAAACATCACGTGAATACGCACAGCAAACTTGAAGTTGTACTTACACCCGCATAT
CTGCGTAGTCACGTCGACGCTCCAGC