Description :
From Genome Similarity Track
Location :
Scaffold_1714:245- 2117
Sequence
1872 bases(100 bases per row)
AGAGTTGAAATCTTCTTTACTTTTGGATGAAGCCGTTCTGGAGTACACAAAAGCAGAACTCAGTGCGCGTATGGGTCATCAATATTGAAAGACCCTCATG
ATCCCTTTCATTCCTTTGTCAAGCAATTTCAAGATGTGGTGTGCCACGATCCACCCTCTGTTCTACCAGATAGAGGTGTCGTTCATGAAATTGACTTAGT
TCTTGCGATTAAATATTGTGTCACACGACAGTGGCCCTTGTCTAAGTAGCAATATGATGTCATTGATGACTTCTTCCGTGCCAAGCACGAGGCAGGAATG
GTGCGTGAGAGTAAATCTCCACATTCGACACCGACATTTTGTGTCAAAAAGACGAACGGCAAGCGGCGTAATGTGCATGCTTATAACAAGCTTAATGCGG
CTACTATTCCGGCACAGACACCTGTTCCTATAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGTCGATGGATA
TTATCGATTGCTCATGCGAGCGAGTGATATTTCGCTTACAGCAGTGAGCAGCTCAAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCT
AATGCTCTGGCAACATTTGATTGTCTGGTGACGCAACTTTTCCGCCCACATCGGGATTGCGCACAGACGTACTTTGATGACATTTTTGTCCATAGTCGTG
CCGAAAAAGGTCGGTAAGATGTTGACAATCACATCGGTCATTGCGAGCCGTGCTCGAGTGCATGCGCACTTATAAATTGTACGCCAACGCGTCTAAATGC
AGTTTTGGTGCAGAAGATATTACTTTTCTAGGATTTTTCATCGGTACGCGCGGCCTCAGAGCGGATCCCGCTAAGGTCAAGTCTATAGTGGACTAGCCGA
TTCCTAAGAATCAAAAAGACTTGCGTACGTGGCTTGACCTTGCCAATTACTTAGACAAATACAGTAAAAATTACGCTGACATGGCTCGGATATTAACTGA
TCACCTTAAGAATAAAATAGATTGGCGCTGGGACAACACCCATGCCGACGCATTTTGGTCAACAAAGGAGAGTCTCCTCCATGCTCTCATTTTGGTGTTG
CCAAACCCTGAGTACCCTTTTGGTGTTGTCTGCGATGCATCCGACTTCGCCATAGGTAGCGCCCTGATACAAACATATGCTGCAGGCCGCGAGCGAGTAT
TCGTATTTGAGTCAGATGAAAGCTGCTGAAAAGAACTACCCATCTCGTGGCAAAGAGCCGATTGCTATGAAGTATGCACTTGTCAAATTCAGAGTACATC
TGTTTGACTCCAAACCATTCGTCGTCTATACGGATCATGCGTCATAACGCACGGCGACACAGTTGTCTCACCTCTCTCAGAGAAGAGCTCGGTGGCTTTA
CTTCTTTGCGGTATATAGCTTCGAGGTGAAGTGTAAGCCAGGCAAATGTGTTGGCAGTTGCCCTCTCTCGCAGACCTGATTATGATCTTGCTCATGTCAC
GAATTTGTCGTATCCTATTGAGGAGTTAATTCGTGAGGCATATCCACAGGGTTCTCAGTGTGTGGCATTATTTCATGCCCTTGGGAGTTCGGAATACAAG
GACTCGGATAGTCAATAATCAGCACGCATGCGGGCCAGCCTACATCGATAACCATCGACAATGGTCTTTTGTGCTATCGCACAGATTTAGCGGATACTGC
TCGCATTGTTGTGCTCACAAATGAAGGATTTAAAGTATCAAATCCTCTTTGAGCCCACGATATTTCCTCAGTGGGCATTTGGGCCGGGAAAGACACACTA
CTGTAGCCCAACTCTACCAAATGGGTGGAGCACATACGTGCGTACATGCAAAACCGTGCCAGTGGGTCAAAC