Description :
From Genome Similarity Track
Location :
contig_103:24497- 26965
Transcript NameFunction/comments
g11038.t1hypothetical protein PHYSODRAFT_339765

Sequence
2468 bases(100 bases per row)
ACTTTCCAGGACGACAGCGCCTACGTGAACGAACTGGGCGATAAGAACAATACGCGATGCATCCTGTCCAGTATGCTACCGCCCAACTCTATTCTGACTG
CTTTGAACGACGCATTCCAAGCGCGTCGATCGCTAAAGGGGCCATTGAGTGTTCGAGTGGCAATCTGTTCAAGACGACTTTCGCTGGCATTCACTTCGCC
ATTTGCGCGTCAGGCAAGTCTGCTTTCACGGCGTACAGTAGTTATATGACCATCAGCGTGGAATACCTGGAGAACCCAGCTAACATTCCAAGACAACGCT
ACCGTGTGATGTTGTGGCGAAGGAGTCGTAACTGGCGCCGATTGTTCTCTTCCTCCTTAAATTTCGACCAGCAATACGCGAACTCTGAAGGTTGCAGAGC
ACTTGGTGATGGATTCGTCGTTGTGCACGTGCGTTATCTTCCATAGCATTGGCAACTCCAACGAGATCGAGAAGCTGCAGAACACGCCGAAAAAGGCAAA
TGGACGAATTGGAAACAGGAACAACCACGCCCCTTGTTGCACAGAGGTCAAATATGCTATCTTGGACACCATGGACTTCAACTGGACAACGATTGCCTCT
AGCAAAAGTTCTGCGCTTGTGCTTTCCTGTTGAGCGACGCAAGCGACGTCGGATCGAGAACACTGATGTTGTAATGCACTCGATGGGTGGGAGTGTCACG
TCAATGGCATCGGTTACTGGAAATGTAGCTTTGGTGAGGGCGCGTCCTGGGTGGCCTTGAGCTCGCCGATGAAGGGGAGTATGGGGTTGGACCACTTCCA
GGACTTCTGCAGCGATGTGTACAACAGTTTGTGTGGCTTCGACGTTGGGATAACGGCTTTATTTCTTTAGTGCGCGATAATCATGTGAGGCAATTGAAAT
GCAAGAGCGTTTCTTTCTTATTGTGTCCAGCGGTGACTTGGAAAGAGACGAGAACTGACCGCGGAAGAAGGCTTTCGTCAAGGATCAGGAATGAAAGCGG
AGAGATATTAAGTTAAGGACGACTGGGACAAAGCATACATTTCTACTACTTGCGACGCGTTTGCTTGATGAAGTGCAAGACCACGTCGCAGTATTTGGCT
TTGAGTGGGTCGGTGGCGTCCAGAGGCGCTACGGACTACTGCAGACGCTTCAGACAGAGCTGCTCGTTCTCCGTCAGCGGGTGGTTAAGTCCGAGGGCGT
CTTGAGACTCGAGGGGCTGTCCTTGAGGCCGCCGATGGGGAAGCCCTCACTCGACATTGGCATAGCGCTCCTTCTATTTGAGTTTTAATTTACTGTGGCT
GTAGTGAGACGTGACTGGGTGTCATTCGTCTTGGGGTATTGCTGGTTTTGTGCCTGCGGCGATGAAGCTGCTATACTGTTTCTGACATGGTTGCTGGGGA
TTGTCGCCCCGCCTGTGCTCTGGGTGTTGTAGATGGTCGTTGTACTTGTTTATGCCATGAGTTGTGCTGCTTGCGTCTCCCTCTCTGTTGTGATTTTCCC
CTCGAAGATGGCGTCATTGCGAAGTCTCCACAGTAAAACTGGAGTGACTGTCGCCCAAATTCTCCATTGGAGCCTCATTGCTCCCGTGTGGTGAGGAGTC
CATCGTCTCATACCTTATTGTTTTTTTTCTTCTAAGAAAGCTGTCTGAATCTGCCTGCTGTTCGTAGTTCGTCTTTCTGGTCCGAAGTAGTTTGTTTCGG
TAGTGGAGATTTGGAGCAAGCGGTAAAGATCGCCTGATTTAAAGTTTGGCCGTGCGATGGGTGCATTGCGGTACGTGCGGGGCCAAAATGGAGTTGGTGG
AAGTGCAACACAAGATGGTGGTAAGGTGGTCCTCTATTTGATGTTTATATGTGTGTGTTTTCCCCTATAGAAGCCTTATAATATGCAAGACGTGACTTGA
TGTCATTCGTCTGGCGTGGAGGAGATTGTCGTTGGCCATGGGGAGTGAATCAGCATAGGTAGGTATGAGTGGGTCTTGCACAGCTTGTAGTGGGTTCGTA
AAATGAATGTTCTTGTCTGTTTGGTGTTCACGAGTATGCGGGCTGCTTCAAGACTTGCTTTCGCTGGGGTGCTCCATTTAACTGTGAACAAGCGTTGTAG
CGTTTGATCCAGTTCGTGAGCGTGGATGTCTCCAGTTGTGGATTTTGTTGCTGTTTTGATCGCTTTCTGCGCTGTTTTATCTACGCTCGCAAGGCGTAGA
TATGTGTTTGCTGCGTCGTCGTGCTGTTCTGCTGCTTGTAAACCGATTGGAAGTGCAAGACGAGAGGCAATGAGTTTGACGATTGAGTATTCACCGCGCG
GATCATTTGAGTCCGGATCGATTTCCAACGCGCACCCAAGGCTCGTCTGTATTGTATTCCCGTCCACTTGCCCTTCAACAAGATCCTTGAAATGGCTACA
GTCTAAGCCCCGCGGAGCGACTCCTCGCCTCACTTTCGTTTTTGCCTCGCGCCCCACACGTGCTCCAA