Description :
From Genome Similarity Track
Location :
scaffold_9:244953- 247301
Transcript NameFunction/comments
Plaha_PHALS_02574transcriptional accessory protein

Sequence
2348 bases(100 bases per row)
CAGCTGTGTTGTTTGGTCAAAAAATGACTTAACACCTAATGTTGTTTCAAGCATTGACGCTATTCAGGATCTAACCATTCAGCAGCAGACTCCCATCCGC
GTGTTGCACCGTAGGACGTTATTGACACGACCGAAAGTTATACATACAGCCAAGTGTGAAATTCTGAACAAGCATTACATGCTTCTTCGTCTGACAACGT
CCGCGGGCACGTATGTAAAGGAGTTCGTTCACGGCGATCGTGGTCGAACGCATCCCAATGTCTCATCAATTTTGGTATAATTTTATTTGCAATTCATTTA
ATTGCAGCAGAAGTGCTGAACTTACTTATTATTATCGTAGGGTTGCGATGCAGACATTATTCAGCTCGATGTTGAAGAACTAATAGGTGGCTAGTAATTA
TGAGGCAACTTCCTAGTCAAAACAGACAAACTTCGAAAAACTATATTCTGTCGTTTAAAAGTCCTGCGGAAAGATGTAATATCTCTTCTCGTTCCTAATA
GTATCGGCCGCACCAGCTCCAAATTTACGTTTGTTTCCAACATTTCAAGTTTGCATGGCCTGTGCGTGATTGCGACCTAAATTATAGTTTCTGGGTAAGC
CAAGGATTTGTATTGGGCCTCGTCCCACAACTCGCCAATCTGGTCTAACAATTCTCGAGCACcttgaggaagcgattcTGCAACCTGTTTATCATTTTCA
CCACAAAAGTCATTGGCCGACAGTGTTGCTGATGACGTTCGCAGCAAGTCCAGCATCCCTTTTGTATTGGTATGCATGCCGCTTTGAGCATCATTCTTTT
GCACAACAGTGGCAGCGACTTTCTCCTTGTATTCTTGAAGGTCAACAATGTACTCTTCAAGTGTGTCTTTCATGATCAGCCGGAAAACGCGAACTGTACG
TGTCTGCCCAATGCGATGTGCGCGGTCCATTGCTTGCTTATCAATAAAAGGATTCCACGAGTGCTCAAGAAAGATGACTGTGTCGGCACCAGTGAGCGTG
AGTCCCAGACCGCCAAGTGATGTAgttaaaagcaaaatgctaaTAGAAGAATCAACATTAAATTGCTGCACGATGCCTGCACGTTTCGCGAGGGAGATTT
GACCGTCAAGACGACGATATGTCACTCTAGGAAGCGCATTTTGTAGCATTTGCTCCGTCAAATCTAGTGTTTTTTGCAATTGAGCGAACACCAAGCAGCG
ATGTGTAGAAGAGCTTGTATCTCCTGAGTTAAAGATGGGGGTTTGATAACAATTCTGACTTTGCGTAGCAATATCGCAACACTCGACTAAAAGGTCATGC
AGTCCAACCATCTTTCCGGAGCTCTTCCAATCCCAAAGTACCTCCTTTTCTTTTGAACTCAGGCCGTGAGTTACGCTTTGATCAGCAACAAGTGCTGGGT
GTACGCACACTTTGCGGAGCAATTGAAGATTTGCTAGCACGTTGGTAGGCACCTTTGCTTTCTGCAACATagactccgaaaactttaCAGACTTTGTCAT
GTCATTTTCTACTGACGATGTCAAGGAGTAAAGTCGATTTTGTAGCGGGGACATCGAAAGTAACACATTAGAGATTATTTTCGGCGGAAGTTCGTTTAGC
ACCTGATCTTTTGTTCGCCGAAGAATAAACGGTAGAACTTTCTGGTGCAATCTTGTGATTGCGATCGctgcttgttctttttgcaCTGTAGTCGAATTTC
TCTCTTTTGACTTTGCAATTGGCAGAGCAAACTCGCGACGAAACATTCCAAAATCGCCCAAATATCCTGGCATCAAGAACTCAAATAGAGCCCACAAGTC
AGTGACATTATTCTGCAAAGGAGTTCCACTAAGAGCAACCCTATGTGAGGTGCGAAGCTTTAAAACAGCACGAAAAAGTTCTGTGGCTGGATTTCGGACC
AaatgtgcctcgtcgagtaCCACATACATATAGTCGattgagctcaaaaattTGATCTCTGCACGCAAAATCGTATAAGTTGTTATGATTAATGTTGGAC
CAAGCCTCGATTTCAGAAAGCCCTTTTGgcaattaattttttttcgatCGATCGCCGGAACTGAGTAGTCAACGATGGACGCAAAAACGCCAGATAAATG
ATTTTTCACCTCTTGCATCCAGTGATGAACAATAATCGGTGGGCATACAATCATGCAAGGATTTACTGGGTTGCCTTCTGTAACGGCCGCTAGAGTAGCA
GCCATGGCGGAAAGCACCTGTATCGTTTTGCCAAGACCCATATCGTCGGCCAAAATCCCATGAAGATTGTTGTTGGCCAGAAAGCACAGCCAATCCACGC
CATGCTGCTGATACAGGCGCAACGATGTTTCTGGGGTCAACAAGGACC