Description :
From Genome Similarity Track
Location :
Scaffold_61:244884- 249452
Sequence
4568 bases(100 bases per row)
TATTTACCTATAAATATACTCAGTTTACATTCTACCTTATTTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGA
GTTTGTATCCTCTCGGGAGATAATTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTATTTAATCCACGCCACCGGGGGTAG
ACTACCTGAACCTCTCCGAAGTTCGTTGCCGTGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGAAAGATGGCAGGCATCT
TCGGGATGGAGGCCCTGCAAACCTGGTGGTGTCAACACCGCCCGAGCAGCTCGAGCGCGTCAATGCCTTCGACGCGTACGAGCAGGGCCTCATCGCGCAT
GTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGCGAGAACTT
TCACTTCTGGGTCCGAAAAGTAGAACTCGCGATGGATGCGGCTCTGATCTCGACCGATCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGT
GCTAAGAGTTGGGTGTACGACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAA
CTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAATAAGGGAGGCGCGAACTGCACGAGTACGTGCAAGAGATACGGGAGCCCACGGCGTCCTAG
TCGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCATCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCAC
CCTCGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGTGTACGCCTGCCTCAGCATGGCCTGGGAGCTCCTTGTCGGCTCCC
GGTCGAACAAGCCCTAACAGACCAGTTCCCATGAAACTCGGGTCCGCCGAACAACGCGACATCCGCCGCTTCGGCTGCAGGAAGATGGGCCACTTTAAGC
GCGACTGTCCCGCGGAAAGACTCCGCAGGCTGTCCTTTCCCAAGCCCGTCCTCAAGGGCCGCTGGTAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGG
GAACCAGTAGGTGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGCAGACTTAGCCCCTGAGAGTCTTC
GCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTAAAGAATCTTGATCGATTCTGGGGC
GTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAGCAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGACAACGGGACGGTGTCAGTACGA
CTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTGTTCTCGATA
TGGATCCATATGATATGATCCTGGGCATGCCCTGGTTTGAGAAGCACGAGTCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCACTACGCAG
TCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGCACCAAAGCATCCGGCAGATGCTTGGGAG
TCGTCGACGTATATGACGACTTCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCTAGTGGGTAACTTAGGTCCACAGGCGGCTAACTT
AGTTCCGCAGACAGCTGCAGCTGTCCCGAACACCGAGAACAGCGTGCTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAG
GAAGACGTCGGATACGCTTCCTGCGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTAGAAAACGCTTCCCGTGTGG
GTAACACAGTGCCACACACGGTCGCCCAGACCTTAAATGAAAAGGAAGGCGTCGAGCACGCTTCCTGTGTGGGTACCACGGTACCACACGAGGCCACGAG
TGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGTCAGCACAGCTCGACGTCACGGTCGCCGTCGTCAACGATGCCGCCGCCTCAAGTCGGATCCG
AACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTTCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTTCTATCACATCTTCGATGGCG
AGACCGGTATACCCGTCAAGGAATCTGGTGTCCACTTGGCAGAGGTTGCAGAGATACTGAACTTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAATCT
CAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGAC
CTGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACTCCAAGGATCCGGTGTATCCTTTGGTGACGAAGTATGCGGGTGTGTTGATCA
AACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATCATTCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGAAATGGCCTCTCCC
GCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTCC
GTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACTACGCAACGGTGCCGGTCCAAACAGCAATCCCACGAAAGGATGTGC
TGTTGAACAACATGGCCGGAAGCGTATTGTACAGTGCGCTGGATTTGGTAGACAGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGC
GGTAAGCCCTCCAAGCGGCATGCTTTGGGAGTGGCTAGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCAGCGCTCAATCGCCCGGTGTCCCAGTTGTTC
CGCCCATTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGTCGAGGGAGGCAAGACGGCCATGAAGGTGCATCTAGGACACC
TCCGTCGAGTGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCGCCAGAGACTAAAGTTCTAGGTTGCT
TCGCAAGCAACGTGGGCGTTCGGGCTGGTCCAGAAAAGGTCAAGGCCATAGCAGCATGGCCAACGCCTCGATCCCAGAAGGATCTTTGACAGTGGTTGGG
CCTGGCCAGCTACCTTCACAAGTACAGCGCATGGTACGCGGGATTTGCTAAGCCCTGGTCGGGCCTCCTTTAGAAGGACGGCGACTGGCACTGGAAGCAA
GAGCACCAGGATGCCTTTGCCAGCATCAAGGCCAGTCGCCAAGAGGCTCCTGTCCTCGCCCTTCCGGACTAGACGAAGCCGTTTAACGTCGTCTGCGATG
CCTCCGATTACGCCATCAGGTGTGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCTAGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACG
GAACTACCCTGTCCAGAACAAGGAGCTCCTGGCAATAAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTGTGGGCTCCCGGCTCTTCGTGATCTACACA
GACCACGCATCCTTGAGGACGGCGACCAATTCGCCTCACCTGTCCCAAAGGATGGCGAGGTAGCTGTCTTTCTTCGCGGAGTACAACTTCCGCGTCGAGT
ACAAGCCGGGCAAGCTCAGCGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTACGAGTTGGCCCATATCACACGGGTGACAACGGATCTATATGATCG
GATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTCTCGTCAAGTTCCTCACGACAGGAACGAGCGCGAAGTCCGACTGGCTTTCGTCGCGACAG
CGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGAGCCCAATGAGCCTCCACGGGTGTTCGTACCCAACGCCGAGGATC
TGAAGTTCTATATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGTCCGCGAGAAGACCTTTCTGTTGGTCTCTCAAGCCTTCTGGTGGAC
CCACATGTACAAGTGGGTCGCTTAATACATGAAGACATGTGAAACATGTCAGCAGGTCAGACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCT
GTACCGGCGGACTGTTGGAAGTCGATGAGACTTGGCTTCATCTTTGGGCTTCCCGCCGACGGACACGG