Description :
From Genome Similarity Track
Location :
Scaffold_70:244840- 251498
Transcript NameFunction/comments
Physo_139129PREDICTED: similar to transmembrane protease, serine 4

Sequence
6658 bases(100 bases per row)
GAAAAGTAACCGCGTTATCGTCACATGATCCAGAGTTTCCACTGTAAGTAAACGGCACAAGAACATTCGCTTGGGGCGGACGAGCCGCAGGACGAATTTA
GCGCGCCGGACAATCGCCAGCAGAAGAGAAATACCAGCTCGAATCAATGCATCACGCTCGTTAATCACCGACACAGCGTCTTCCTCCAGTCCAGCGAGAT
GAATCGAGTCGTCCGGGCCCGCTTCGTCATCCGATTCAAGGGGCGTCGAAAGTGTTGCTAGCAGAACAGGGTCTGTTAGGACGCCCACAATGGTTCGCGT
CACAGCGATGCAAAGCTCGTTGAAGCTTTCCGATGGTGTGTTGCGTGCTGTAACGATAGCAGTGTTCAAGAGAAGAAAACACTCGCGCACGAAAGCGGGC
GAGTGATTTATGTGGTCCCGCAATAGCAGCAGTATGTACTGGGTGGGTAGTTGGCCATGAAATAGCATAGCATACCGTCTGATAACCAGTCGAAGACATC
GCACGCACAGCAGCGCCCACTTTTCATCGTGCTCTACCGCAAGCTGGTCGGAGAGATGCCAAGCTAATACGACGGGCTCAGCAATCTCATACGTCGTCGT
CAAATCAGCCACTTTCGGGATCAGATACTCCACAAAGTAATCGTTGACCACGAGCTCGTCATGCATGGACGGGTACTCCACATAGAACATCTCGTGATCC
CAGCGCGGCACTTGCTCACCGAACTGGGCCACCTCATCGTCATCACCATTATGTCGCCGTCGCTCCAGGGACTCAATTTCTGCTTGCAAAGCTTCACGTA
ACTCGGCGCGCATCGACGCTCGCCAGATAAGTTCCGGACTCTCGTGTGTCCGTCGAACAGCCTCAATAATTTCTCGCCAGTGCTCGCCTTGTGCGCGAGC
GTCTCCCAGCCAGCGCTCGAATGCTCCGCCACCAAAATTCATAGCGTTATACGCGAGCGCCACGACGCGATTCCGCTTGTTCTCGCTACTTGCACTACTC
GTGGAAGTATTCGACGTCGCGATCGATGTGCGTCTCGGCTGCTCGAAATCAAACGAAAAGTGCGGCAACGTCCGTGCACTGCGGGTCGCAGCAGCAGCTT
TGGTTTGCGCCATTACAGTAGGAGACGTCGTAGTGTGCCGCGACATGAGGTCAGCACGGTTCTTCGCTGGGATGAAGAGCTCCACGGGGAAAATACGGTA
CATCGCCTTCTTCGAGCGAGTGTTGCCGGCGCAGAACACCTCGACGAGATCGACGCACAACTCGCGCCTTTTACGTTCTGCTTCGTCCTCGCTCTCCACC
TTCTTCCCATTATCTGTAGCTTTCGTCTCTTCATCCTCCTGTACTGCCGCTGCGAGTGCGTACAGCAGCGCGCCGTACTCCCTCGCTGACTCCTGCAGCT
CGTGGACCTGGTCCAGATCCACAATACGAAACAGCTCCTTCACCAGCCCAATCGCCAGCTCCATGACACTGTGCTTGCTGTCTCGACAATGACACAAGTC
CAGCAGCGACACGCGGGCATTCATCAGCGCCTCCACCGCCTGCGAGCACGTCATCATATCCGTCGTGGCTTTCCTCGTCACCAGCGTCAAGTGGAAGATC
TTGAGCACGCCTTCCAGCACGGCTGCCGCCTGTTCCTGCTGCTCGTTCTCCCCCACCGCAGCTCCGTATTGCACCAGCAGCGAGCGCAGCACTTCGTAGC
CTCCCGCATCTCCGAAATTGCGTCGATTGGCGGCTTCGCTCCGGTCTGCAGCCTTGTCGCCGGGATCAAAGCCCGGACAGGGCTTGAGCATGAGCTCCAG
CGTCTCCAGCACCGACAGCACGAGCGACGGAGACGGCCGGTAGAGGCACGTGAGGAAGGGCTTGAGCGAGCACTTGGCGCAGAGCTTGTAGAGCTCCCGC
CAGCGGATCACGCGGCGGAAGCTCGTGAGGATGAGCCCCGTCATGTCCCGCCCATTGCGGCGCTGCGACTGCTCCGTCTGGTCCTGCAGCAGGCCGTGCA
CCACGTCGAAGAGCCGCCGCTCCTTGACGTCGACGCCCACGACGCTGCTCAGCAGGTTCGGGTCGGCGTCCACCGGCACCTGCAGCTACAGCCATATAAT
AGTGGTGAGAGAGATAAAGTAAAGTAAGATGGTAGACTATGGTAGAGCTCTGGTACCTCGAGCGGGAACAAGGCGCAGAAGGTGCGCAGGACCTCCTCCA
GCTCGGTGCTCGAGACGTTGGCGCGGCGCAGCGACAGCACGTCGCGCAGAGCGCTCTTCTGCTGCGCGGAGCCGGCCTGCCCCATGAAAGGCGTAGCCGT
CGAGAGCCTCTGGTGCTTGGTATCTGTGTCTTCTGGGATTGAAAAATGCAGGCTCGGCTCGAAAGGCACCGCTTCAAAATCCGTTTCGTCGAACTATAAT
GGATTGGAAGGGTGAGAGTAGGCATAGAGGTATTTTAATGAGAGATATAGAAGGGAGGCCATTATTTGAAGCATATCATGCACTATGTAAGGGTTTTGTG
TTCAGCTTTTAGTCGAAACCTGATTTGCAGCGAATGGGTGCAACTCGGATGTATTGACATGAAGTTCATGCATGAGCCCCCTGGTGGATGGATGACTTAC
TTCTGCTTGGTGGTTGTGAGCTCACTCTGCTTGCTCTGGAGTACCAGGTCGCTCTCGGCGGACTCCGACCCCGACGTCGAAGTCGAAGTCGAAGCCGAAG
CGGACTCTTCTTCCTCGACGGAGGTCTGCTGGAACGGCGAGTCCTCCGACGTCTGCTGCTGGAAAGGCGAGTCCTCCGACGTCTGCTGCTGGAAAGGCGA
GTCCTCCTCCACGGGAGCCTTGGTGGCCTTCGTAGCCTTCGTGTTCTTGGTCTTGCCCTTCACCAGCACAATATCGTCGCTGCCCGACTCCTCCGAGGCG
CTGGTCGACTCGCTACCCATGGCCGAGTCTATGTCACTGGCAAAGAGTTCCTCGCTGCCACTCTCCGAGTTTTCCACAACCGGAGCCTTGGTAGCCTTAG
TTTTGGGGGCCTTCGTAGTCTTGCCCTTCACCAGAACCGCATCTTCGCTGCCCGACTCCTCCGAGGCACTGTTCGACTCGGTGTCAATAGCTACGTCGCT
GCCGCTACCCGAAAGACTGGACAGCAACCATGTCAGGTCAACGGAGCTGCCGCTGCCCTCGAAGTACTTGAGCAACCAGTCCGAGATGTCGCCGACGCTA
GAGTCCGACTCGCTGGCAAACAGCCGCGACAAATCGAGGCTGCCGCTCTGCGAACCCTCATCATCGTCATCATCGTTCGAAGCATCCGACTGCTCCATCG
AGCCGGAAGCCGGACCGAACTTGCTGCCGTCGCCTCCAGCGAGAATGTCTTTGATGTAGTCCATGACGTACGTCAGGCGAGTGTAGATGCCGGCCTGCTC
ACCGCACTTGCTGCCCCAGCTCACACAGCCGATGATGATGTCGTCGTCGACGATGAGCGGGCCGCCCGAGTCGCCGTTGCACGTGTCCTCGCCCTCGCCG
GTGCCAGCGCACAGCATGCCCTCAGTGACACGACCGACGTACTTCTCAAACTTGCCGCACTCGGCGTTCGAGATGACGGGGGTGGTAAGCTGCATCAGCA
TGGGGCTGCCGAGTGACCCGCTAGTCTCCGTCCTCCCCCAGCCAAGGACAGTGCCCATAGTACCGACCTTGTTGTCGGAGCCGTCCTCAGCGCACAGCTT
GGCCATTTTGCGCTTAACGGGCTTCTCCAGCTTGAGCAGACCCACGTCGTACAGGTGCTTCGTTTTGTTGTACAGCGGGTGACGGAAGCCCTCAACAATC
GGAACCGTCAAATCGCCGGCGCCACTGCTTGAATTCGTGCCGAAGGTGGCGGTCATGTCCATCTCGTCCGTCTTGATGCAGTGGCCAGCCGTAAGGATGT
ACTCCGGCGCGATCAGTGTGCCGCCGCAAATGTTCATATCCAGAAGCGCAATGCGGATGCTGGCAAGGTACGGGTACTTGTCGACGTCGGCCTCCGAGCC
GCCGTAGATGCGGCTCTCTTCATTGGTGGTCAACCCCGTGCTCTCCACGGTGGTTGTGTCCTCCTCCTTCTTCGCGACGTCCGAGAACGAGTAGCCATAC
GTGGAAGCCGTCAACAAGGCCAGCGTCGTAACGAGTGTGCCAACCTTCATTCTTCAGCTGGAAGTGTTGACGCTGTGATTATCTGTCGAGGAAAAGCCGA
AGTGACCTGCTTGTCCGCGATTACAGCGGTTGGCGACCACATCCCAATCCGCTATCCGTCAACCAGACGGTGCTCGGGGCTTGCACCGGCTAGCATTCGC
TGAGATTGGCAAGCCTCGGAGCTCCGAAGATCAGTGATGTACAAATCATCCATTTTTCACGCAAGTTCGAGGCCAAATGCATAGGGAACAAAAGTCAATA
CACGCAAGTTCTACGACTACAGTAGAGTATACAACAAAATGATCCAAATTTCTTCATTTTTTTCGTACTACCGGTACCGTATGCATTATCGGAAAGCTTG
TGAAGTAAAGTACTTCACGCCATCTACGAGTGATTTTCACTAAACATTTATGATGGCCGGTTAGGGACGAAACCTGATTGGTCGACTTCAAACGAGATTA
TCTCGAAAGCTCCAAATAATTTCTAAGCATCGTACCGTATCATATGTATTGTGCCTTTCGGTCATTTTGCCGAGTCCTACGTAGGACTTTGGAGGTCAGT
TAATCTGAGGTTGGTGGTCTCTAAATCTGAGATGCAAATCTCGGACGAGTCCGATGAGTGGTCTCCTGGAGTCTCTCCGTTCAATGGACTCCGGTTGGAG
TCCAAGTCAAGCAATCTTTGTTTGGGGAAGCAAGCAATGCCGGAACCCGCGAAGGCGAATGACGACGACTGGAGTGTTTAACGTATCGACTGCACCGTGT
TTTCTCTGCGTTTGACATCCACCGTATTAGAGTCAGCTCGTATGAAAGTCCTGCCACAAGACTTGGTAGGAGTCCTTCGTAAGACCTCAAACCCCGAATG
CCGTGAAAATGGGCGACATTCGGGCTTTCGGCTGTTTGTAGGACCTGCGCAAGTGCTTCCATCGGACTAGCAATTCTTGGTCCCTACGAGAGACCTGCTA
ATCTGCTCCGATAACCTAGCCCCATCTTAGCAGGTAGCTGTTTTACACGTCCGATTTGCCAAAACAACTGAAAAGCACAATAAGTGTCTTTTTCATAAGG
CCACTTTTCCGAATTTCCGCGCTGGGAATTTTGTATCTCGGTCGTGGGAAGGCGTGCGGGGTACCGTTGTAAAGCTGAGCATCTCCTCTATCTCGTTGAG
TTTTTATGGGCGGTTTAAGCGCTCAATAGCGCGCGGCGACTGTTCAGAGAGGCGCAACCAGTTGGCTACCACTTTGGCTTATATTGCAGTTTGTATGGGC
CTCTTTTTACTGTAGCGCTCGTACGGTGGTTAGGGGTACGACGCTCACTTCCGAAGTAGATATTTACTATTGAGAACGGCAACGACGGGGTATTTTAAAT
AGAAAGGTCAGCGATAGTTCGACAGTGTACTCACCAAAAGATTGTGTGTGCGGTCGAGGCGCTTGTTGATAGCTTCAGTGGCATGCTCTCAGGGCCGCAG
CCATGGCAAAATTATAACTAGGTGTTGGGTTAAATCACTTAGGTCGCTTGATTAACCAATTCAGACCACGTGTACTTTTATAAGTAAATTATGAGGTCTA
CCGTATTCTAGATCTCATACTTCATACACCATATTATTGAAGTTGTATTGTTGTATTTTGTCTTAGCACCATTTCTCCCTTTTTGTGCGTATTTTTGGGC
CTTTCTTGCCAAAAATGGTCACATTCTGTCGCCAATGCACATCTCTCCGCTATGAATGATGAGATATCTATGTAGTATGAAATTTGAAATACGGTACTTG
TCAGTAAATGCCGACAATCTGCACAAAGCGAGCGAAGCGCTTCTGCTTGTCAGCTCGTGTGCAATGGATATTGTACCAGCGTATCTGGCACAATTCCTCA
TTCTTCAGCGGCTAGTAAATCACTACGCCCCTCTTTTCGTAGACACTCAGAAGTTAGGAATTTCCTCACAATTAACACATCGATAGCTCTTCCTCAGATG
AAGCTCCTCAAAATAAGTAGCACCCCGCTGCGTCAACTTGCCCGTACTGACCACTCTAAAGCTGTTGCTTGTTGGGATATCATTCATGAACGCAAATAAC
GTACTACAAACTCTTTAGACCACCTTTCTTTTGTTTTCTGCTAGATGACGCTTAACGTTTCCGTTAGCTTTCTCACCTCCACATAAGTGGTTCGATGCAT
TACTTCACCAGATACATTCATTCTTAAGTCACAAGTAAGATGTATGTGGTATTACTCGGAAGTCAGTGAAGTGTACTCTCACAGTTAAGTAGCATCCAGG
CAAGTGCACTACCATGAGGACGCGTATTAATGGGAGCATTGTGGATCAGCTAGATCGTCATTTTAGAAGTGACGTGGCCGACTTTGATGGGGCTGCCCCT
GACAAGGGAGGGGGCTGGCGCCCCTCATTTTGGGTCTTGTGGTGTGGTAATACCACTTAAATTCTCTTCTACCAAAAGGTATTAGAGACACCAACAACAC
GCAAACCCGCAAAGGTAAGCGCTTATTGGATCAAAACCTGAAGACCAGGAACGATCCC