Description :
From Genome Similarity Track
Location :
Scaffold_248:24482- 26781
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_248-abinit-gene-0.55DNA ligase
Pytap_DAOMBR444maker-pag1_scaffold_248-fgenesh-gene-0.3Bifunctional folD protein

Sequence
2299 bases(100 bases per row)
TGGACGGCAAGGCCACGAGCGAGCATCTGCAGCAGCATGAGCTGGCGCCGGCGTGCGCGGCGTTCCTGGAGAGCCACGGGAGGCGCGTGGGTCTGGCAGT
CGTCGTCGTCGGGAATCGCAAGGACTCGGCGACGTATGTGCGTATGAAGCAGAAGGCGAGTGCTGCCGTGGGCATGGCGTCGTGGAAaGTGCAGATCGAG
CTACCGGAAGGGCTGCAGCGCGTGGAAGATGGCGGGGACATTGGAGATGTGACGCCCGAGCAACGCACGGCGATGGAGACGCAGGTGATTGAGGAAGTCT
ACAAGACGATCCGAGAACTCAACGCCCGCGACGACGTCGACGGCATGATTGTGCAGCTGCCGTTGCCGCGCTTCTGTGACGCTGATGCGATCCTCGCTGC
AATCACCCCGGCcAAGGaCgTCGATGGCCTGCATCCAGAGAATCACGCGGCGCTGTTCCAGTTTGCGACACACAAGGCCGTTATGCAGGGCAACGCCAAG
CGTGAgaCCGTTGGCTTCAGCGTCCCGTGCACGCCAGCCGGCTGTATCGAGCTCTTGGACCACCACGAGATCCCGATTGAGGGCCAGCACGTGGTCGTGA
TCGGCCGCAGTCAGATCGTCGGCCTCCCCGTGTCGCTGCTGTGTCTGCATCGCAATGCCACCGTTACCATGTGTCACTCCAAGACGCAGGACTTGCCTGC
TCGTGTACGCGAGGCTGACATCGTCATCGCAGCTATCGGGCGGGCCAACTTCGTTCAGGGAGACTGGATCAAGCCAGGTGCAGTCGTCATTGACGTCGGC
ATCAACGCCGTGGATGATCCGAGTAAGAAGGCCGGGTACCGCCTCGTTGGCGACGTCGACTTCGAAGCTGCGAGTCGTGTCGCCGGTGCCATCACGCCCG
TACCTGGTGGTGTCGGGCCGATGACGGTCGCCATGCTTCTCAAGAACACGGTCGACAGTGCTCTTCGTCGCGTGGGGCGCACCGCCTGATCCGCGGATCC
GACTCCTCTGCCTCGCAGGTCGACGATTCATCCACCTCCGACGCACCACCATCTCTCGCTTCGCTGTCCCCATCACGTATTCGCCAGCAAACCGAGAGTT
ACTAGTAACGTTGACCACTATCTCCTCTATCAACGCTGCACATCTCTACTCCTCGTCCTCATCTCTTTCATCCCCTTCATCCTCCGATGAGAAACAGCCG
CTCTCTTCCACGAGTTCCACCTCCTGGTGAAGGTCCTCCCAATCGTACTCCGTCTTCATGGTCCGCACGCCACTGGGTGACGATGGGTGGTAGTAAGACT
TCGCCGACGCCAGTTCCTGCTCGTAAAGAATCGCGTCGGGAGTCGGAAGCAACAGTCGCGCGCATTCTTCGAAGCCCCGTGACGCTGCCACATGAGCAGG
ACTCTCCCAGTCGCGGTTGAGTGCATTCGGATCAGCCCCCAGTACCAGTAGATGACGCACCACGGCGGTGCGACCAGCCGATGCGGCCCAGTGCAACGCT
GTGTCACCTCGAGCGTCCGCCGCCTGGAGGCTCACGCCACACAACTCGCTATCAACAaGCAGTGACAGCATCTCAGCGGCTTCAGATGCTTTCGTGGCAT
AGTGGAGCACGCTGACTTGCCAGTCGTCGTTCGCAGTACAGTTGGCTCCACTCAACATGAGCTGTCGTGCAGTGTCAACATGGCTTTTGACCACGGCGAG
ATGCATCGGTGTCCGTCCGTGGGCGTCTCGCAAGTTGAGCACCTTGTCTTTGAGATCTAGGGTCTTTAGCGCATCCATGAGCTGCTTAATACACTCCGTG
TGACCGCGCGAGGCGAGAACGTGCATCGCCGAGAGTGCAGTGGCGGCACAGTAAAGCTCCAGCAGTCGGTGCTGTGCCTGCCCCTCTTGGCTGTGCTTGA
GGATGTGGTGCTGAAGCAGGACAGCCACCTCGGGCTGATCTCGCTCGCACGCGTGGTGAAACGCATTCCTCCCGTCTCTGTCAACGTCCTTCCACAGCTC
TGGGCAAATCCCTAGCAGCGTCTCGACCAAACACAGGCAGCCTTGCGCTGCAAACACCATCAACGGCGTTTCCTCGTTGGCGTCGCGCCCAGCCACATCG
ACTTTGGCTTTCTGCACAAGGAACCGCAGCATGTTGGTCCGCAGAACCGCCGATTCCGAGCTGAACGCTAACATGTGCAGCGCCGAACGTCGATGACACG
GCTCGAATGCATGGAGaTCaGCGCCTTGCAGCAAGAGGAACTGTGCGTCGTCGACCGAAGCCGCCTCCACGGCGTCAAAGATCGTGAGTCCACTTGATG