Description :
From Genome Similarity Track
Location :
Scaffold_1708:2448- 3837
Sequence
1389 bases(100 bases per row)
CAGGCCCATTCTCTTATTTCTGAGAAAACACTTCACCACAATCGCCTTCTGTACGTTGTCGGCGCTGCACAACAGCGTTCACGGCGTGCATTACCAGCAT
CCACAACCGCTTTCTCCCCTTCGCGACACATGTCTCCCGCGAAGCGTACCGGCAAATCGTCGGGCAAGGCCCCATCCACCACACCTCCGGTCAGTCCGTC
TTCCATGTCGCCCACCGATCTGCGGGTTCTAGCCCAGGCTCTTTCCGATCAGGTGCAAACCCTGACGGCGGAGCTCCAGACGGCTCAAGATGCCCAAGAC
CAAGCTGCGTCTCTGCACACTACCCAGCTTCAGACCTTGCGAGCCCAAATCCATGACCAGGCCATGGAGATCCAGGGGTGGGAGCACCGTGCGGCCTCTC
GGTCGCAGGACCTGCGACTCTTGTTGGCTGATTAGGCGGTCGAGATCCGCGACCTGACCGGACGGCTGGATCGCGCCTCCCGTCAGCGAGATGTCATGCG
GGATGACAACGACCATCTCCTTAGGGAGATGGCGCTCGCTGGATCTGAGATCCACCAGCTCCAATCCGGGATCCGCGACCTCGAGCGGGATCTGGAGGAT
TCCCAGACTGCTGGGGCCGCTGCGGATGCGAGCTTGGACCGGCTCCGTGACGAGTTGCGTCTGACCCAAGAGGAGGTGGTGACCAACGACTATGTGGGAT
CCACCCATGGCGGATCCACCTTAGGGTCGGCGCGTGGAGGATCTCCCGCGCCCAAATCCACCTCTCTCGTCGCCGGATGTAGCTCTGGCTCAGCTTGCTG
AGGAGTTGCAGGATACCAAGGAGTCGCTCGAGAAAGCGTCTGCCGGACGAGATTACGCGCTTGAGGAGTTCGTGCGTATAACTCAATTACGCGACGAGAT
CCAAGCGAAGCTGGCGGACAGCGACCTCCAGCGGGACAAGGCGGCTACCGAGTGGGCGGATGCAAAGCGTACGCAAACAGAGCTGGAATCCAAGCTTCGC
CGCACGAGTACGTGGATCCTCTTTTACCCCTTGCTAGTAACTCTATATTCACTTGTTATTGTCGATCCAGGTGACAAATTGAAAGAAGCCCGACGCGACC
GCCGCGAAGCTCCAGGATCATTTCGCCGCAGCCCAAGCTCAGCAGCAACAGCTGATCCTGGAGCGCGATCGTGGCTTGTCGGAGCGGGATTTGACACGTC
GACGACTGGCGCTGGTGACAGCTGCCGTTTCGGATCCCCTTCCTCCCTTGTCGGGGCCATCTCATGCTGCTAGCGTCTCCGCTCCTCTTCCGACTGTAAG
TGGGGCGGATTCGTCGGCTGCGAAACGCCCGCGTAGTGCATCTCCCGCTCCTAGCACCGGATCCTCCCGTCCCCATAAGTAGGCCCGAG