Description :
From Genome Similarity Track
Location :
Scaffold_22:244793- 247869
Sequence
3076 bases(100 bases per row)
AGGACTGGTATGACCACTCTGGGCAGAGAAAGAGGGTGCAGAAGAGCTGCAAGGTGTGCGCTATGAGGACGGAAGGCAAACATTGGGGCGACTAAGACCT
ACTTTTGTGACAGCTGCGATTTTGTGGGGCCGATCTACTCTTGCGTGAACCGAAATGGCTAGAGTCCGGCAAAACGATGAATTGCTGGGATATTTGGCAC
AAGGTTTACAAGAATGGCAAGGCAATCCCGGAGAACATGAAGGGCAAGTTCTGCGTGCGTGCATCAAAGACGACGGGATCTCCAGAAAAGTCACTAGCCA
AGCGCCGGCGCGTGGACACCAGGGCCTCTGAAAACTCTGAAGAGTCTGCGGACTTTGAGTAAGTGTAGCAGTAATTCGCATAATGATTTTTTTGTCTTTT
GTGCGATCTATGGTCATTCGTTTCATGAGCAAGCAAGCTGACTGTTCTCACTTGCTCACGCTTCATTGATGACAGGGAGTTGACTAGACACTTGACAGCC
ATTAGACAGGTCATCCCACATTTGGCAGCTTCGATTGGTTCAAAATTGCGATCGTCATCATTGATTGCTACATGGATGATATCAAGATACTTAAATAAAA
TATGCATAAATCATTCTCCTCTCTGTTGCACGCTTTCTCGAATTTTAGAGATAATTTTCTCTACAGATCCGCTGCTCTCTCCCGACTCGACAAGGGGCTT
CGCAGTATAAACCTTCATGTGGGCAAAACACGTTCTCTAGCGCTTCTGTAACAGCGTACATCGCTAATGTGTAGCTGTAGATAATCCGGATAGAGGCACC
TATGTACGGGTGTATATACAGCAAAGGAAACAACCAGCCCATTCTGGTACGGACTCTCACACGTCCCATCCTACTCCATTCCCCTAGGCTATGCTGAAAC
ACATATAAACGTACCATGTATATACAGCGTATGTTAGGAAAAGCCAACAAAAATCCTCCGGGTTGAAGGGGTTAAGACTAGAGAGTATTAGCTTTACCGG
GGGGGGGGGGGTCACGTGGCTGCACGCAAAAGGCTACAGCATACTTGGTTGAAGTCAATATCTTCAACCAATTAGAGTAGTAGAGCTCTGTCAACCATTC
GTTGATAAGTACCTTTCATTAAAAATACTAGATTAGGAGGAAAACCCAAACAAACAAACAAACAGATCGTATTTTTACCTGAACCCGCTTCGCTTCTCTT
TTTAAGTAAATGTACGCTTTCGTACGAAAGTATAGTTAATCTAAGCGAACACACATCTTACGCTTCCTCATACATGTGCGCTAGCGTGCAAGCCGAAGTA
GTGGGCTTAGAGTAGGCCCTTTCCAGGTAGAACCCACGAAATTCATTTACCGATGTTACGTTCTATGGGCAAAACTGGAGGGGTCCTTTAAGAACCATTC
CCGTTTAACCCCTCAGTTATTAGTGTCATATCTTACGACTTTAAACAAAAACTTAAAAGAGTAAATGGCTCCAAATCAAGGCTCAATACTGTAACCAGGT
CAAAATTGTGCGGGGGGGGGGGTGATAGAGGTCGCGTGTCTTGGCTTGTGCGGATAAGGGAAGAGTAACCACTCGGGGAGAAGACCGGACCGAAGACACT
TGAGGGGAAGAAGGAATATTCCGAAGGGATTGATTTATCGGAGCTTACCCTGTCCTCACTACCTAGGTCATCCAATCACCAACTGTAACGGGCCATGTGT
ATACTCCGTTACTTGCTTACACTGTAGTGTTGAGGGAAGCTCGCAATAGGACGACTGAGTCTTAGGTTTAAGGAGAAATCAACTCTGACTTTATTTTACA
GCCATGGCCACAGCCCTGGCCACTCAAATACACGTCATATTCCAATTGGCTAATAATGAGCCTTGCTCCCCATATATCAGCCAATGGCACGACAGAAATT
CAGAACACGCTAGTCGTTTGCTGATGCACCTACTTATGTAAAGAAATCTACCTACTTATGCTACATTACCCCCTCTGGAAGTTGCACTTACGCAGCATAA
GCAACGGGCGAAGAGCAAATCAAGCTATGTGAGGATGGCGAACGGGGACTTGGTTAACGGGCGGAGCGAACCGGGGACGGAGAAATCTCCTGCCAAGCGC
AGCAGCGACACAACTCATCTTGCGGAGAACTTGACAAGCAACACGATGGATCAGCAGCGGACAGGAACACCGACGACGGCGACGTCGTTGACAGCAGGGA
CAACAGCAGCGGCACGCGGTACGTGCGTGATGGACGACCAGCTCCGGACATGGGCTCTCTACGATATATCCGAAGCGCGGGATCTAGACACACTGGACAC
GACGAAAGATCCCTTCCGGCGCTTCCGTGGGCTGCGGCAGAAGTCTTTCGATAGTGTCGCATATGGCGTGTTACAGGAGTCGTGGCGCACTTTCATCCGG
CGCTGGACTGGACGCAAGAAGAAGGGGAAAGCTTCGTTGGCTGGCTGGTATACCGCGAGGAGATCGTCAAGGAGCACTCGCTCACGGAACTTCGTAAGCG
CGTCTGCACCAGCACATGAGAGGACATGCGCCGTATTTGTTACGTGAGGGTCGCTGATGGCTGTAGTGTTTGTACCGGGCCGCGTCCGACTGTCGAGGAG
TAAAGCAGCCACGTCACTGAGTATCCGCTTCGTGAACAAGAACACGGGTGGTAACGGGACTGCACGCAAAATGCTACAAATAGCCATTCGGCTACTAAAA
CGTTTTTTCACGCTTGTGTGAGGTACACCAATGATTATGTTTGACAGACAGTTGCTCTTCATGCATTTAGGACATGCTTGGTTGAAAGTCAATATCTTCA
ACCAATTAGAATAGTAGAACTCTGTCAACCATTCGTTGATAAGTACCTTTCATTAAAAATACTAGATTAGGAGGAAACCCAAACAAACAAATAAATAGAT
CGTATTTTTACCTGAACCCGCTTCGCTTCTCTATTTAAGTAAATGTACGCTTTCGGACGAAAGTATAGTTAATCTAAGCGAAACACATCTTACGCTTCCT
CATACATGTGCGCTAGCGTGCAAGGCGAAGTAGTGGGCTTAGAGTAGGCCCTTTACAGGTAGAACCCACGAAATTC