Description :
From Genome Similarity Track
Location :
Scaffold_3:24476- 26574
Transcript NameFunction/comments
Sapdi_VS20SDRG_01101hypothetical protein

Sequence
2098 bases(100 bases per row)
AGCTTACTATATTCAATACCAGCGCTCGGTCGTCGCGCAGCTTTTGCTGTCGCCTGCCATTGCAGCCCGCTACATGCAAGTGCCGTCGTTGGTGGCAGCG
ATATCCCCTCCGGCGTGGCGTGGAGCCAACATGAGTTACTTTGGGGGCAACCCCATGTGCCTCAACGCCAAGCCCCAGCCGTTCGTCCAAGATCAGTTTG
GTTTCTACGATGCGTGCGACGCCCAAGCGCCGGCGACTCTGATGGGCACGCGTCCCAGCCTCTTTTTTTCGCTCGTGACGCTCGCCGTCACTGACGAAAG
TGCTATCGTACGTCGCCTCGACGCCATCTGCAACTGTTGTGCTCAAGTCGGCGGATATCACACATGTCTGGCGACGCTCAAGCCACTTGCTGCGGTGGTT
GCCGCCTTGGATCTCTCATCCCTCGCGACCTTCGCTGGGAATCTGGCTCTGGCAATGACGCAGCTGAATCTTAGCATGATTCAGCTAGGGATGAATGGAA
CGTCGCCCGTCTTCTTGACGCAGCCCGCGATCGCGCAGGAAGACCCGTGGTCCTTCTGTGGCTGGGCAATGGTTTACGACTGGCTGCAAGGTACGCGGGA
GGCCGTCGAGTTTGATACCGACGCGGGTGTGTACCGCATCTTGACAGCATATACAGCGCCGAGCCAACTGCCCGCAAGCCCCCTCGAGCTCCCAAATCAA
GTGTGCGCGTATGTCTGGCTCATCCTTCTCTACTCGAGTTTGCTCACGGGTGCTGTCGCCACCCTTGTCTTGCTCGCGTCATTGCGGTCCCCCGGTTGCC
AAGTGTTTGCTTTTCATCGCGTCGCAAGTCTCGTGTGGGTCGGGCGACCCTTTCTTATGCTCCGGGGCACGACGGCTCTCGTGATTCTCAGCACTTCGCC
GATGCAGTTTGCATCGACTGACAGCTTTACGCGCTTCACCTTTGTGCCCCGCACCCCATGGGACGTCATGGTGCTCTCGGGCGAGGCGACGTGGATAACG
TACGTGCTCGTGGACCTCGCCTTGCCTGGCGCCGAGTCGCACGCCAAGCTGGCTGCGCCACTGAGCGCGCTCATCGCGTGGCTCACGACGCTGCTCATCG
AGGTAGCCGCACCGTACGAAGCGACGGCAACCTTTGAGCAATCGTGTGAGATCGTCCAACTGGGCCTCGCAGCGTCGTGCACGGGGGGCGTCGTGCGCAT
CGGCAGTCGGGAGCGCCTCGGCGTGTTGCTCCTCGTGCACGTTAGCAGCGTCGTCGTTTCGTTTCTGGTAGTGATGGCACGGCAGAGACGAGGTTCAATC
ACCGACGTGCGGGGCAGCGACCTCTTGCCGGCGTCGGCGCAAGTTTTCTTGGCGCGCCATGCGACGTGGCACACGCGGCCAACGACCGTGATCATGGCCG
GAATGTTTCCCCTTGGCGGTCGCATGTTTGTCGTCAACCTCTGGCAAGTGCTCGCGGTCAACAACGCACTCCAACTGCCGTCGCAAAGCAGCTACTCGTG
CATCCGAAACTTTACTCTCTGGAAGTTTGGGCTCGTCGAGGTCGGGGGCATTGTATACGTCATCACGTCGGTAGTTGCTAGCTACACGTACATTTATGTC
TCGTCGACGGCGATGGCCAACGACTTTTGGTGGGCGACCTTCAACGCGACCGGTCACCAGACGTTTGTGACCAACTGGTTTACGCAGCAGCTCCAGGTCC
ACCGGAACGGCTCGCACCTCGATCTCACGCAGCTGATCTACAGCGACAACTCAAATTTATACAACACCACAGCCACTGCGATCTCAGTCCCGATGCTCTA
CGCAAGCATGATTCAAGACGAAGCCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN