Description :
From Genome Similarity Track
Location :
scaffold_168:24475- 27365
Transcript NameFunction/comments
g4978.t1hypothetical protein

Sequence
2890 bases(100 bases per row)
ACAAAAACACGAAGAGGGCGCCAGGCTTCCGTCGATCCAGGCTCATTGCGCGAGTTTCCCCCATGGCTGAGCCGCGCAGCATTCGCCGATTTCTGAGGAG
TCGCAGGCACAAACACTCTCACGCGGACTCCTTAAGCGAGGAAGAGATCGCCAGCACCAGCAGCCTCACGTCCGACTTCACCCCGTCCCTCGCCATGGAG
GGGATGCTGAAGAAACGCGCGGCCAAGATGCCCGTGATGCACGACCGCTACTGCGTGGCCACGTGGGAGATGGACTCGGACGACCGCAAGTGCGTCATGT
TGCGCAGCTACAAGAGCCGCAAGAACTACGACGCACACCCAGAGAAGCCCACGAGCGTCCACCAGCTTAAATGCATCAGCGACTGGGACGGTAAAACCGG
TTTCCACCGGTATCAGCACGCCTTCACGATGGAGACGCGCGACAAGAAGCTCTTCCAGTGTGTGGCTCCGTGTGCAGCGGACAAGGACAAGTGGGTGGAG
CTCATGGCCATCCAGTCCGCCTTCAACAGCGGCCGAGACATGCGGCTGGGCAGTGTGGGCAGTCTCGTGCCCTTGAGGCGCACGCAGAGCGTTGAATCCG
CCGCGGACAGTGGCAAACCACGTGCGTACACCAGCGCGTCCATCGGCAAGCAGAGAGGGGAGAGCGACGTCAACGCGGCGGATGCAGAGCATTCTACGGA
CTCGGAGGACCAAAACCACTTCCCAGGCCACGACGGACTCTTCCGGACCACATCAGGAGCGTCCTCTAACTCGTTGGAGCTGCCTAATGGAGATAAGAGC
GAACCTGCGGACTGGGGACTCTATGGGGAAACCAACGGCGAGACCAAGTCCAAGTACGAGATCCAGGACGACGCCAAGCCCGTGCTTCTGGACAAGGAGC
TGTTGGATGCTCGTGGAGAGACCAAGACGTTGGCGTCGGACAAGTTCCTGTTCGAAGAGGCTGGTGCCAGCAGATTCGGCACTGTTGTCGTCAAACCAGC
GGCTGGAAGCGATGACGAAGATGCCGACTTCATTGACGAGGAGTTCGCTGCGCGTGAGGCCCAGAAGGAGAACGAAAAGAAGATGAAGCGCCGCGCGCAG
AAGCTCGAGTCCAACCGCGACCTGTACGCCGAAATGGCGGCTACTAGACTGGCCAACATGCGCAAGGACGCCCGCCACCCGAAGAAGAGCCACAGCCGTC
CGTCTGATGAGAGCGACGTCGAGGAACACGTTGAAGACGAGTCCATTGGGGTTGAGAGTGACGTGGAGGACGTTACTGAGTTGGAAGAAATACAGCAGCG
TCGTAGCAGTCGCAGCCGACGCAGTTCCAAGAGCCACAGGCACGATGAACACGAGTCAATCGCTGTTGAGGGAGAAGTGGAGGATGTTGTTGAGTTGGAG
GAAATGCAGCAGCGTCGTAGTAGCCGTAGCCGACGCAGCTCCAAGAGTCACAAACACGTTGAAGATGAGTCCATCGCTGTTGAGGGAGAAGTAGAGGACG
TTGTTGAGCTAGAAGAAATGCAGCAGCGTCGTAGCAGCCGCAGCCGACACAGCTCCAAGAGCCATAAGAAGAGCTTCGTGAGTAGCAGCGAGAACGCCAG
CGTGAACGGTGGATACGTCAGTGGTGACGACGAAGAAGAGGTGTCTCCTGTAGAGGTGGCCACTACGGCTGAGGTGGAGAGCGCAGAGGCGGAAGAGCTG
AGGCAGTTGAAGAAGAAATACCGCGCCGAGCGTCGAGCCAAGAAGCGTCTGATGAAGGAGAAGGAAGAGGAGGAGCGGACTGCTCAAGAGGCAGCGGAAC
TTGCTCGTGCTCACCGTGAAGAGCAGCGTGCTCGTGAAGAGGCCAAAGCTCGTGAAGAGCAGGAGAAGCGCGATAAGAAGGAACGTCGCGATATGAAGGA
GAAGCTTAAGCGCGAGAAGGCGAAGCAGCGCCAGGCTGAGGCCGAGCTCCGGAAGCTGGTGGAGCTGAAACAAGCCGAGGAGGAGCGCAGGGAGCACGAG
CACAAGGAGAAGAGGGAGAAGAAAGAAAAGAAGAAATCGAAGAAGAAAGAGAAGTACACCTCGCCTGCCGAGCGTATCCACAAGAAGGAGGAACGTGACG
CTGAACGTGCTGCGGCGTCGGCTGCCGCGGAAGCTGAAGCGCAGATTTCGAACGCTTTGGTTGTTGTGGAGAAACCGGCGGAACCGGAACCAGTTCAGCA
GCCGCTTACAACTCCCGAGCCCACTCCGACACCAACGGCGCCGGTTGTTCAATCCGACACTGCTCCTGTACAAGCCGCCGCCCCCGTACAATCTGCCGCT
GTACAAGCTGCTGCCCCCGCAACCGCCCCTGCTAGTATACCTGCTCCGGTTGCCGCTGCAGTTCCTGCGCCTGCTCCTGTTTCTGCTCAAGGCGCTGCGG
CGATGCCGATGTACCAGGTAGCTCCGCCACCGTTCGTACCGACATATCCAGTCGGTCCACAGAGCATGCCTGCCTACGGTCTGGCCGCTACATTTGGTGC
TTACCCTCCGCTGTACCCTGCTCCGTACAGCTACGGCGGGCCTGTCGGAATGCAACCTGCGTACATGCGTCCCAACATGGGCTACATGGCTGGACTGAGC
GCGATGGGGTCATTCGGCAAGGCTGCTGGTCCCGACCCGGCCCCTTCCTCCCAAGACGCTGCTGAGCCCATGATCGGCCCGCAGCTACCGACCCCAGGAG
AGCGCGCCGCTGCCTCCTCAGCAGGTGCGAGCGCTCCTTCTCCACCGCCGCCACCGTCGAGTGGCGCCAAGTTGACCAACCTGCCGGAGTTGCCGGACGT
GGTCGAGTTTTAGGAGATATGTTGTTCGCGTTGCTGTCGTCGGAGAGACCGGTTCTAAGTTAATTTTCAATCATTTTTGCCCCATTCAGC