Description :
From Genome Similarity Track
Location :
Scaffold_24:244698- 249965
Transcript NameFunction/comments
Physo_133093predicted protein

Sequence
5267 bases(100 bases per row)
ATTCGCAACGTGGGGTTCCTCAAACATCCTGTCAAGTCCGACAAGGTACCCGCATGTTGGAGTAAATCTATTTTTCTTGATGGGCCAGCGACGTAGGGAC
TCGTCATGGGCAGACACCACCACGCCAAATTTTGTTATGAACAACTCCTGGAGCTCTGGACACGCAGAAGACAGTGCGCACAGGTCGATGTAAATCCCAG
CCGCGACGCCGTTCTCCACACCACCATACAGTGATAACGAACGAAGACCGCGGGTAACTAGCGTCAGTAACTCCATCAACACAGCAGGGGTCTCGAACGT
GCCAGCGTTTATTACCAGCGATCCGCACACTCGTTTCTTCTCTCGGAAGACCGGTTGGTCATAAGCGGGGATGAATTTGAGTCCTTCTCCAAGTTTCGCT
TTGCAAATACCGTATCCAGGGACGACAACATTCACCGACGACACACTATCGGTTGGGTCATAAAGAGCCCGGCAGCGAGATGTACACGATGCAACAAAGC
GAGCACCATTATCACCATCTATCTCGGTCGGATACAGCTCGGTTTCTTCTCAAACATCGACATATCCATACGCATGGGAGCCTTGCCCCTTCGATCTCAA
CATTGGTCGGGGGTAGTTGGACTGGAGTACGGCGGAAATCGGCAAAATGTCGGACCTCGTCAGTGCACCACGCAAATAAATCTCGATTGCTGGTAAGTAC
ACGCACATCTGATGTCCCGCAACAGAGCGCGTAAATGAGCCAAGGCCATCGTCCAGAGCCCTCTAACTCAATGTCAAACGAGGGCAAATGTGTATTAGCC
GACAACTCCGCAACTGCCGAGCAGATCGCAGCAAACACCCCAGTGCATACGTTCGAGGACCGTAATGTCATTTTCCTAGATGTCACCGGGATACGAAGAA
GCGTTCTACATTTTTCCGGTCACAAGCCGCCTCGAAGAGGCTCCACACACCAAAGTGCTTAACAAATTCCCAGCGTTTAGCATAATTTGCCTCGAATTCG
TCGAAACAACGTTCAAATCCAGCGATAAATACGCTCTGTCGGTCCTAGCCAATGCAATCGCCAATTCGGAGATGACGGGGTGATTGCAGTTGTATATCGC
TGCAAGCACCGCGATGCACGGCCCACTTGTTATACCTGGTGATCCCAGTGGAACCGCGAGTAGCACACATCTGCACAATCGGAGGAACGGTGACATCGAG
CAGTTTTTCGAAGTTGAACGTGAACTGAGGTCGAGGTGTTAGCCGCTTTGAAAGGTTCCTATTCTCCGTCCAGGCGTGAACCTTGAAGGCTGCACAACCA
GCCAATCGAAGACCCACCGTGAACAAATGCTTTGCTAGAATCCTCCACTCCCATCGCTTCTAATGGCTGAGCTGCTGCTCGAAACTTAGGCGAGTACTCC
CATGGATCATTCGGGAAGCCGAGGACCCCCCCCCCCACACACACACGCGTCACTTCAGTCGCGTATATTTCGCCAACGCTATGCGACAAAGTCCCCTCAG
GCCGGAATTTCCATTCGGGGAAGTAAACGAGGAGCTCACCATTCTGTGCAATCTTGATCCCCGTCCAGGACTGCAGCAGCTCGGTGAATGATTGATTGTC
CACAAACGAAAGCAGTGTGAACAGTTCCATGGCCTCTCGAAGTCGTTGAAGTCTTGTTGCATCTCGCTGCCCCCACTCGTCTACTGGAAGCCGTAGGCGG
ACTTTTAGCTGCCTCGCAGGTGTCGGATTATATCTGGATAGGCAAAGGACACTTTTAGAGCATTGTCTTGTTTCGAGCTATCGCGTAAGACAGCCCGCCA
AGGCTCGAGGAAGTCCCACTTGGTCGAGTAATAAACGTGAGGCAGGTCGGTCCATATCAATTAAGTGGAGGGGGGGTCACAGTTAGACAACTTAGTAATG
GACTGATGACAAGTAGCTTGACACTACATGCTCACGCGGTCCTCGACTTACAACTTGGAGTCGGCCACGACGCGCGACTTCTTCTCCATCTTCTTGGACC
AGCCCTCCAGCGTTTCGCGCGGCATGACGGGCTTCTTGTAGAGGTAGTGGCCTCCGTCCACGATCAGGACGTCGCCCGAGACGAAGTTGCCCACGGGCGA
CACCAAGTAGAGCACCGCGGCCGCGATGTCCGTCTTGGCGCCGACGCGCCCCACGGGGATGGTGCTGGCCATGTACTTCTTCCGCTCCTCGGGGTCCACG
TCTCCGCCGAGCTTGGCCGTGCCCGTCGTGTCGGCGATGGGGCCGGGGGCGACGCCCGTCACGCGGATGCCGAACTGCCCCCACTCGAGCGCCAGCGAGC
GCGTGACGCTGTCCACCGCCGCCTTGGCCGCCGACGCGTGCACCTGGTACCACGTGGCGGGCAGCTGCAGCGTGGCCGTGATGTTGATGATGCGGCCGTC
GCCGCTGCGCTTGAGCGGCTCGAAGGCCGCGCGGCTCATGTTGAAGGTGCCGATGGTGTCGATCTCCATGACCGTGCGGAAGGCGTTGGTCGAGAGCTTG
TCGGCCAGCGCCAGGAAGTTGCCCGCCGCCGAGTTGACGAGCACGTCGAGCGAGCCGAAGCGCGCCGCCACTTGGGCCACGGCCTGGTCTGCGCTCTCGG
CGGAGCGCACGTCGCCCTGCACGTACATGCACGCGTCCGAGGCCACGCCGCGCTGGCGCATGAGCTCCATGGTCTGCTGCAGCGCCGTCTCGCGGCGGCC
GAAGACCGCGACCTTGGCGCCGTACTCGGCCAGCGTGAGCGCGATCTCCTGGCCGATGCCGGAGCCGCCGCCCGTCACGAGCGCCACGCGCCCGGCACAC
GCGTCGCGGCGGAAGGTTCGCTGGATGCTGGCGGAGTCCATGGCGGGAGGTAGGAAGAGAATACAGCGCGTGGAGCAGCGAGCAGATTGGGAAGTGCTCT
GCTCTGCTTCAACAACGCTTCGTATGCAACTGCTATCGGGAATAATCCCGTCCTACCGCTTGTATACAGGGGAGCACGCATGATTTTCCGCCGTATACAT
GTATACACCTACCGTCTAAACCGGTTCGATCGGTATGAGCCGGCTATGACGTATTCGTACCCGAAGTGATTAACGCAACCTTAATAGGAACATAAAAAAT
CCCAGAAGGTTGCTCGAGCAATCTTATATTTTTGTTAAAGTTGCTTGAGCAACCTTGCAATTTACGATACATTTCCTCTACTGAGTAGCTTACCGCAAAA
TTTCTACTTGGGGTAAGATATTCGTACTGTAAAATTGTCAAGGTTGTCCAACGCGGCCGGAAGCTCGTGCGAAATATGCTTCATTTCGCAAGATCCAACG
TGGAAGGCAAGCCGAAGACGTAGCAGCAAGCGCCATGTTACCCCTGCTAAGTAAGTGTGTTTGCCATGGCTTGGGGGTGCGAGTACATCTAACCTGTGCC
TCTGGACAGTCAGTAGCCACGTCCAACGGCCAAGCACTGGACGGAAGTGGACGACAGCCAGCGACTGGATGGCTGGAAGACGCTGCGAGGGCTGTGCGTG
GATGCCCACGCCAAAGAATGTGCGTGGAGGGCTGCGGCGAAGACTGTGGCAGCGAAGCGCGCCTGGAGGCATCTTATGGTACGTTGCACTGTGCGGAGAA
AGTTGTAAGGTGCTTGCGTTCGTACTCCAACGTGTACCGCCTGTGCGCGTTCGAGCAGACATGAAGATCACGGTTGCGGTCCGGCAAATCGAGATCACAG
CCAAACCTAGATGGGAAGAAGCGAAAGCTAAGCCGCGTAGGGCGTAATATATGGTGTGGATAGGGCTTGAACAGCTATGTTGGCTATTACTGTATGCTTG
ACGGATTGGGTTTGACCGGGAAGTCCTTAGCAACTACCATTTAGCCGGAGAAACCAGCGCTATGAGACGACGGTCTTGGTAGGTGTAGGCTGCACTTGTC
TATACTCGATGTCTTGGCGTGATGAATATGAATTCTGTTGGCCCATGGCCCCATGCTCGAGGCCGATTGGCTTCGCACTTTTGATCTAACGCATCGCCAA
CAAGTGGCATGCTTGCACCAGGTAAATGTGCTGCTTGAGTTGCGACTATTTTACGCCGACCTTCGCCTGCATCTCTCTCCTTCTGACACAGAACTTGCGG
TCCTTTTAACTAAGACTACTTCGTGTTGCACGCGGTGCCCGTAGAACCTGGCGGGCTGCTGAACCACGGCGGATAGCGTCGTGGTGGTGATAGTATCGCT
TGATGCGGTGCAGCTCCTTCCTCTTAGCGTGTTGAGGCCAGCCCGTATGATCGTCAAATATCGATCTCAAAATTGACGCCGCTATTGTCATTTTCTCCTC
GATAAATTACCGGTTGCTGAAGCAACCAGTAATTTTAGGGTTGCCAAGCCGTTTTTAAGGTTGCGGAAGCCTCTTTAAGGGTGCTGTAACCGGTGTCGTT
GTGTCGTAACAAAGTTGCTTTACGGACTGCCATTCGTACCGTTTACATACGTCATCCACGCTATCTCATACCGGTTCATATCGGTAAGAATACGAGTCAA
AGACCGATTTAAGTAAGGGTACAGGGCACCAATTTGCCGAGGGAACCAATTTGCCACCTGTATCACCTGCGTGTAGTTTAAGCACTTCAACATGCAATAT
CTTCGCGATCTGCCCGCTGAAGGATGCTAGTCTTTCCACAACTTGCCTACCCGCTAAGAAAACCCCTGCCCACATCGCCAGCTAGACCTCACTCCACCTC
ACTCCTAAATATATCGCAGATACCTCAAGACTCACCTCGACTCGGTTCACCCTTCAGCATGGCGGTTCGTCGACACGCATCTTCCGTCGCCAAGAGCAAA
ACGTCGAAGGCTTCCCTGAACGCTAAGGCCAAGACCACTTCGCTGCCGAAGCGTTCCTACAACCCCCCCATACAACCCATGTCCTCCAGCCCCTCGACGC
CGGTTGTTTCCGGTCATTTAAGGCAACGTGGCGCAACACGATCGAAGCCTGGACCGCCGAGCATAGTGCTGCAAACCTACCACGACACTGCCGTGCTTCG
GTCATCGGTGACACTCTCCTCGAGTCATTGGACATGACGGGAATCTCAAAGTCGTGGAGGTCGACGGGTCTGTGGCCAGTCAACAGGGAAAAAGTGCTTC
GCAAGATCAAGTCCGTGTGCAACGCTGCAGTCAAAATACGCCAATTTGTGGCCGTCCATGAACCGCTTCCTGTTGATCAGATCGACGAGAGGGGTCTCCA
ACGCCTACGAAACGAAGACATTGACTTTGCTGGGTTTCGTGCATACAGCATCGTCAACCGAGACCTA