Description :
From Genome Similarity Track
Location :
Scaffold_75:24469- 26120
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.3Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.12Conserved gene of unknown function

Sequence
1651 bases(100 bases per row)
ACGGCTCGGAGAAGTCTTCATGGACAAACCAGGCTGGATGGACTGACCTTTTCGCCTTCATCGAGTTGGTTCAGGCTGCCAACGGCGTTGTCCCCGCAGC
AGTGCTCCGCCGCACACTCGAATCAGCCTTCCCGAATGTTTTCGGCATCAAGTGGGAGCAGAATCACGTCGTCGCGATCGAGCTGTCCCGGAACGGATTG
CTTGGAGCGCTGCCCGTCGAACTTGTTCATCTGCGCGCGCTACGAACCCTCAAGCTCCGCGAGAACCCAGGACTTCGTGGTTCTGTGCCTCCGGAATTGT
TCTCTGATATGCCGTGTCTGCGTGGCTGCTACTTGGACGGCACGAGTCTTACCCAAGTGCTGCCGCTCACCAACGTCCACTCGATGGAGATCACGAAAGT
CCACGGCTCGGGCACCACGGTAACCGTCAGCTTTTGCACGGGCGGACCGCGCAGCCTTCACAATCCATCGACCGTCCAGACGCACTGGCTCGCCGATGTG
ACCGAGGCCGAGATGTTCATGATGCACACGACGCTGGTAGCGCAGCGACAGACCAAGAACCCGACCACGGCGCGAGTGATCACGCGCACGGCGAGCAATG
CGACGGGACCTGAGCGGATCGCGGCCGCCGTCAAACTGCAGCGCATCTATCGCGCGCGCATGGAGCGCACCAAATTCCGCCACTTTCTGCGCTCGTTGTT
CGAGACCAAGATCGACGCTGCCTCGGGTTACCGGTACTATGTTGACACGCGCACAGGCGAGGCGACATGGGAGCGACCAGCCTTCATCTCGACGCCGCGT
TCACAGAGTGGCGGCCAGTCATCAGCAAGCGGCGAGATCTTGGAGGCGGGAACCGAGGCATGGCAAGCCTGCGACGACGGCAGCGGCAATACGGTGCGGT
TCAAAAGTGTCATAAACAGATTTTGTTGTCTATGGAGACTGACGCCGTGTTGCAGTACTACTGGAACAGCACAACAGGCGAGTCAACGTGGGAACCGCCG
CAACTTCGATCCAGGATCCACGAGGAGCTACGCATGCGGTACGGCGCCGACAAGACGGACGAGCAGTGCTTCGAACTCTTCTTCCAAGACATCGACATCG
ACAACACTGGCGAAATCGACTGCGACGAGTTTGCACGCCTGTGCGGCGATCTTGGCATGGCCATGTCGTCCTCGCAGATCGCGCACGCATTCCGCCAGCT
TGACACGAGCGGCGATGGACAGCTCAGTCGTCCGGAGTTCATAGCGTGGCTGACATACAATTTCTAGTCGCACTTGTTGCGAATAATAAAATGATACACG
AGTGGATCTTCCGATCATCACTACTCGTCACTCAGCAGCTCCACCAGCTTCTCCGAGTCGGCGATCGTCCTCGTGAGGCCGATGATCTCGTTGGCACTGA
TCATGTACGTGTCTGTGCACGCGCACCGAACAGAACGCTTCGCTCCAGTGCCATGCTCACTGCCGATATCGATCCCGGCTGGCTCGAAGGTTGCATCGAA
CTCGACAATCACCATGTCACCGTTGGCGTGCATGCGCTTCTCTTCGACCGAGACCACCTGCACACACCGGTTAAATAGCGAAACGTACTTGGCCACTCCG
TGTTCGCCGTGGTATGTGCCCCAAAACGGGATTTCCTCCGGCACGTCCGAC