Description :
From Genome Similarity Track
Location :
Scaffold_19:244683- 246596
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007650Similar to infB: Translation initiation factor IF-2 (Salinibacter ruber (strain DSM 13855))

Sequence
1913 bases(100 bases per row)
CAAAGTTGCGCTTTCAGATCATCGTGCCGTCCGCGGTACCGATTCAGAATCATATCCACGTACGGGATCTTGTCTGGCACTTTTGCCGTGTAGAAGCGAA
TCAGCCACTCTCGAAATTGCAAGTGCTCGTCACTCTCATGCGTGCGCTTGCGCACCTTGTCATGGTCATTGGATGCTGCTGGATGCTGCACTGCAGTCTG
AGAAGGTGCTAACTTGTCAGCTATATCACCACGTGCGCAAAGGCAGCATTGGTCATCGGAATCCTGCTGCTTTGTGGCTGAATGTCGTAGGAAAACAGAA
AGGATCTGCATATGCCGATCGGTCTGCGGTTCAGACGCATGCCACTGTGCATACTCAAAAGACTCGGTGCTATTCTTGCTTGCTTGGGTATCACACACAT
CGTCAACGGCTTCGACGCATGCGATCTGCGGATACTTTCGTCGCACAAAGCTCTGGATGGCCCCCAAGAAGCCTCGAAAACCCACTGGACCGTGCAACTT
AAGTGTTGCCGCGCCGCATGTGCTCAACGCAAAGATCATTCCCGGCACGCCACTCACCGACTATCCTACGCAGCCCCATGACGACAGAAAACAAACAGCA
GCATTACGACAATTGCGTATTGTAAGAGAAAACACAAAGCACCACGTACATGGACGTCAAAGCGCGTGAAGAACATGGCGTCCAGTGAGCTCAGCTTGAT
GCCGTTCTCGCCGCAGAGCCGCTGCGTGCCTTCGCCGCAGTTGAACAAGTAGCGCTTGAGCAGCACGACATCATCGCTGTATACGCCGTGGCGCTGCACC
GAGAAGAGCAGCGACGGCTCCGTCCCATCCGAGCCCGTACCAACGACCTCCGCCGTCACCTGCGCAGCATAACCACATAATAATGAGTGGATATAGACAT
ATATAGAGAGAGGTAAAGAGAGCGGCAGCGTACCGATATCCGTCCTGCCATGTTGCTGCTGATCTTGGCGAATGGAGCTGTTGGTAAATGGCGCCAATTC
GTACTTTATGGGGAAGTGGCGTGGGCCAATGAGAGCAAAGGAAGAGGGCAATCGAACTTATCAATCAAGTTCGATATGCATATTAAGTTCGCTTCTCATT
GTTAAGTTCGAGCTGCTGAAAATAAAGAGTAGCCATGTGGCGAGGCTATTTGTATCACGAAGAGCTCTCCGTTAATGGTGGGCAGGTCATTTCGACTTGG
CGCTGCGCGCAAAAGACCCTCTTGTGCCTCCAATATCTCCCATTTATACGCATTGGTACCAAGCAGAGTCAAGCGCCATGAATGAGCTTGAAGCGGCAGC
GTCGCGTGAATTCCTCCAGGCGTTGATCGTGCAGTTGAAGGGTGACGCCGAGAGCAACGAGATTGAATACGTGATTGAACACATTTTTCCAGTGCTCGTG
CCAGGTTCAATGTGCACTCCATGAAAGCACTCTTGTAGTCTGTTTCTCATTACTTGTATGCATTTTGTGTGAAGCGATCATTCACTTGCTCCAGACCAAT
CATGAAAACCGGCGGCGCGACCATGAACGCGAGCAGCATGTGCTGCCGGTGAAGCCCCTCGACCATCTCGCCAAGTTTTTATTTCGTCACAATCCTCGTC
ATGTCGAAGCAGTGCGTCATGATGCGTGTGCCTTTTTGATGTATTTATGCGCACATATCTCATTTCTATGTGCTGCTCGAATACACAGGACAAGACGACG
CTGGAATTGCAAGCTATGGCCAGAAGACTATTGCGCAAATAGAACCACTTCAATACACATTCCTCGCATTTTTTGCATTCGTGTCTTCATCGCTCATTCG
TACACAAAAGGAGAAAAGCGCATCAAATGATGTCTATGGCGATGGTGAGCGCGATGGCATTGGCGAGGACTGTGGAGAAGGCGACGGCATCGGCGATCCG
CCTCCAGAGTTGG