Description :
From Genome Similarity Track
Location :
Scaffold_3:2446083- 2451216
Transcript NameFunction/comments
Phyin_T30-4PITG_02529Protein kinase%2C putative

Sequence
5133 bases(100 bases per row)
GCAGCAACTTACAGAAAGCTGCCCTTTGTGAAAGCAATATATAAAATTGCCAACCGAGAAAAGTTAAGAGTTACACTGCGTTGAACAGTATTAAGTAAAG
CTTAATCAATTGTCAGTGTGGGCGGGACATCGCTCCGGCAATCTTGCGGCATCCTCGGGTCAAGCATCGCTTTGCACCTCCATGATTCAAGCACTTGCCT
CTTGTCACGACACGTTTCTCACATCCTGGATGCGAGCATTGAGGATTCCCGCCATGAGAACAACATTTTTCCGTTCTTGTTCTGAAGTCTGGTACAGCCC
GCATGCGAGCATCGAGCTTGTCCTCCATGCGCAGTACATCTGCCATTACTGTACCGAAGCTTGGTGCAGCCCGGGTGCGAACATCTCTTACCTCCTCCAT
GTACCGCACACTTTCCCATTGTTATAACTTGATTGACGCATCCTTCAACGGAACCTTGATCAGACGCCAGGGGTATAAAGATTCCAGAAAAAACCAACCG
GTCAACGGTAGCGTTGAATACGAACATATTTCTTCCTTCTTGTAGTTTGATCGTGCTGGTATCAATGCCTTCCAGCTTCACCATCCTCTAATGAGTTAGT
TGTTTTATCCTTTTGAGAAACGACGTCGAGCTGCCTTTCAAGTTGACGGTAATAGTGCAACGCAAAGTTTGCGTCCACCATGTGCTTGACACATGCCTTT
CAGCTGAGCTTGCTTCACGCATTCGGGAAACGTGCAGCGAGGCTTCGCTTGCAGTAGCCCAGGATACTTTCTGTGCGCCAATCTTTCCCTTCATTTCGCC
ATCCACCTCGCTTCCTGGCAACAACGAGATCTTTTGCTCTTCGTTGGCGTTATTTGTAAAAGTGAGCAAAAAATCGCTGTCCTTTATTTACACAAATTCA
TGAAACTAACATCAATTAATACGTAACATCACCCCGAGCTATACCCAAATGGATCGATCTTGCTGGTTGTTCCTCAATGCAACAGACTTGGCCATCGCCG
TGGAGGTCGCCGCGCTGGCACTAGCTGAAGCAACAGCCGTTCTAGCAGCGATCGCTGCTGACGCGCGCTGACTCGAGACTAACGAGCAATCTAACGCAGT
GAGCACTTCCTGCATGGACGGACGTTCGGCGGGCGAGTCATGGAAACAGTTCTGCATCAGCGTTTGAAGAGATTCCGGTAGCTCCTTAGGAACAGGAAGA
CGTTCGCCACGTAAAACATTCATCATCGCCTCTACAGGAGTCAGCGCCGCAAACGGTGGCGAACTCGTGTAGGTCTCCCACATCAGCACACCAAACATGT
AGACATCTGAATCGTATGAGAACGCGTGGGGAGGCTGTAATGACTCTGGGGCCATGTACTTGACTGGACCCACAGCGTCTTTCAAAAGCATTCCAGTCTC
GGCTCGCACGCGACGACAGAGCCCAAAGTCGCAGATACGTACACGATTGCCTTGATCCACGAGACAGTTGCGTGCAGCAAGATCACGGTGAATGAAGCCA
CCTTCGTGGATGTTAAGCAGTCCAGCCGCAGCGTCCTTTAGCATCCCAGTGCGTTCATCGATCGAGAGTGAAGAACTGCCACGTAGATTGTCTTCCAGAC
TGCCATACGGAAGATACTTGGTCACCAAAGCCAATGGGAACTTGGTGTCGGTAGAAGCACCCACAAATGGGACGATGCAGGGGTGATGTCCAAACATATT
CAGCATCGCAGCCTCGTGCTGGAACTCGCGAACAATCTGCGACGTCGTCTCGCCGAACTCGCTAGCTCGAATAGTCTTCACCACGACATCCTGACCGTCC
AGCGAGGCGCGATACGCGTCACCGAAATATCCTTGTCCTACCAGCTCCTTCATCTCTAGCGACCGGAACGGAATCTCGCGATACGTCTGTTCCATCACAT
CCATCCAGCCCTCCAGCACGTCAGCTTCTAACTCGCTAGGCTGCATCACACGCGAGCCAACAAGCACGAACGAGTTCAGCACGGCGACAGACGAACCCAC
AGTAATTCGCGCTTTAAACAATACACGTCCAAACGCAGCGCCATCTGTACACACCACGTCATAGTCGACGTTCGAGATCTCTCCTTCCCATGCGAAGCCT
TGCGTGGCACCATTCAGTACCTCGAATCCGTTGGGCACTTCCAGCGTCACGTGCACCAGAGCGCCACGACGGACGTCTAGTTTGGATTCCAGCGAGAGTT
TTCGCGCCTCAGGGTGGTCACTCTTCGCCAGCTCTTGCATCTCGGATCGCTGGTTCAAGAGGAACGCCCAAACTGTAAACTGGAACGGCTTCAGCGACGG
ACACACACTTGGTGGGGCGAAAGCACTGAAGTTCACACGATCTCGACGACCAGGGACGTCTTTGAACTCCGCTTTCGCATCCACACCGCCTTCCTCAGCC
GCCATTGTTGATGCAGACCGGCGAGACTCAGGTACAGCAGCCATCTGGATCGAACGGTACACTTGCTGGAACTTGTCGGTTGGGAAGTCAGCATCGTGTA
TACTGTTGGTCGGAGACAGCAAGTCGTAGTCGTGATCGACGTCGAAAGACCCACGTCCTACCCCGCTGCTTCTGGGTGAATTCATGGGCGAAAAGCTGTC
GTAACCTGGCTGCTCCGACGAGCCTCGGTAGATCGGACTTGAATCCAAAGCCGTGATGTACTGCGGAGGACTATCCGTATAGCTCAGCGGCGCATAAGCT
CGCATATTTGTCATGTCGTCATCTTCGTAGGAACGGGCGATGTTTCCGTAGTGGCCTAGTATTTCCAAGTCGCTGATGTCGCGCGATGATCCAGCCTGAG
ATGCCTGCGCAATACTCACCGACCGTTTATCTTCTCGCGCATCATGCTCCACGGTGTCCAGTTGATCAGAAGTGTCACTAGTGGAGCGCACTTGATGGTC
TGACAGCGTACTTGGTCGCCCCCGGACGCGAGAAGATAGCGCTCGCTTCCTTGGATCTCCATTAGTGCTTCGAAGCAGCGGCGTACTTTTTGGACGGACT
GGCGGAGCTGCAGGAGCAGATATTATTGGTAATACTGGTGGAGCTGGAACTGAAGGTGTTGCTGGCGATGCATGTCGCGGAACAGTTGCTTTATCCTCCC
CCGACGACTGTAATTGCATCTGGATAGTATCTGGTCTACTCTCCGGTGCGTAGAACGCTTCATCGGCTGCTTGGTCGATCTCTCTTGCAAATCTATCACG
TTCTCTGGCGGCAATGGATCGCTCGTGGCGATCAGCATGTTCTTCACGTCGTTTATCAAGTTTTTCTTGTGCTGCTCGAAGTTTCTGTTCGTATTTCTGC
ACTTTCCTTTCATACCGTCGTTGCTTCCACTGGGCATGCTTGTGGCGAAATTTATCACTTGTCCAGTCTCCATCAGCCTCACCAGCCACCTCTCTGTCGA
CATTTTTGGAGGAGCCATCAGTGCGCTGATGTTGACCTTGTAACAGCCCACGCATAGCATCCTCCTTGTCCCTTCTACGATCGCCGTCACTTTCGTCTTC
ATCTGACTCGGAAGTGCCCATCGCTTCATCTCTGCGACTATGCTCTTGGCGACCAGTCGGTTCAGACCAGCTCTTTTGTGTCGAGTCACGACGATAATGG
TCATATGCCCCTTGCAATTCTACCGAACGTGCATCGAAACTTCCTCGGCGTGTTTGTTGGGAAGGGAGAGGTGGAGCAGATGGACTTAAGTCCAGCGCCT
CATACATACTTTTATGCGCTGGTTCCTTCTTGACGACGTCGTCATCAGTATCCGACACAGTTGCGGCCACAGGGACAGCGACAGCATACACATCATCGAA
GCTGTTGCGCCGACGCACCCCTCGTCGACCTCTTCTCTGCCTTCTCTGGGCCTCATGAGGCCACCTCCAATCATGCCAATGCGACCAATGTTCCAGCCAT
CGCTCACGCCAGTCAGCGCCCCACGGTGACAATTCGCCATTCAATGGCGGGAAAGGTGGAGGTCCACGCATATCCAGCCTCATTTGGTCGAAGCGTAACC
CTCCTCGTCCTCCTCGACCCCACGTGAATCCTCCTCTGCTATTTCCCCTTCCACCGCCTCCCCTGCGTCCACCACGACCATCAATCCTATGCTGATCATC
ACTCTCATCGATCCCTTTAGCGTCAGACTTGATAACAACCTTGCAGCAACACATTTGAAACTCCTGGTCGTGGTCATGATGCATATCTTCTTGAAACGCC
CGTTCAGCATGAGGTAATGGTCTATCTGTAGCCATTACAGGCATCCCTGGAGGTACATACGCACCGTCGAAGCTTGCTGGCTGCTGTTTCATATCCCTTG
ACCCTCTTGGTCTCGATACATTCGACTCGCTACCACTTCGGCGTTCCTGGTACAAATTCCGCGTCACAGCTTCAGCCGACGGCTTCTCGTTCGACACTGA
CGCATTGCCACTTCCTTGACGCGAGCTTGAATGCTTTCCACCCATCGTTCCATAATTATTTGATGCTGCAGCTCCAATACGACGCTCTTTCTGTCCAATT
TTAAAAGGTGCTCGATCAATGGTCTCTTCACTCGTCTCCTCTGGAGCATTACTTGCAAAAAGCACTCGCGCCACATTTCTAGACACGAATAGTAATCCTC
TAGCAGAGGTGACCCCCAATTGATGCGCCAAGAAGGCGAAAGCCACTGCTGCGAACACCTGAGCAGCTGTAGTCCCCGTGGACACAATGTTCACATCGGA
GAGCCCTGCATCTTTCGGTAACACTTGAGCAATACTCACGATCCATAGTGCCAGTGGCACGGCACAGAATACCAGATCTAGGATCCATTTGAACACCAAG
AAGTACAATAGCGACAATAGCATCACTGGGAGCGTTACCTCCCCCAATACTGGTCCCTGGATGGTTTGCTCTGCGTTATGACTTGACCTGCGCCGCCTTA
ATATTGACCCTGCCTCGTCTTCGTCCGCTACAAGCGCGTCGATGGCCATTTCTGTCTTCCAGAGGACCCTCGTGAGCTTTCGAGCGAGCTGCGACGATCC
AGCGAGAAGACAGCCAATTACGAGCAGGAGTAACAGTCCGGAAGTGGCTAGGATGACTCCCAATATACATGCAAAGGCCAATGTAGCCACGTGAAAGCTC
AGTGTCTGCACAACAGAGGCCACGACGCCTCTC