Description :
From Genome Similarity Track
Location :
Scaffold_431:2445- 9378
Transcript NameFunction/comments
Phyag_g5650hypothetical protein
Phyag_g5651hypothetical protein

Sequence
6933 bases(100 bases per row)
AGAGACGGGATGCGGCTCGCAGGCCCCCGCGCATCCGACACTTCGGGACCCTCCtggttgtcgttgtcgtcgcccTTCCGGAAGAACGCCACGAGGTCTG
CAAACACACCAAAGCTCACCTACAGCACCAGGAATAGCAGAAGAGTCAACAATGGTAAAAGCGCCGGTCTTGTTGATGACGTACATTGAAAGGATAGGAA
ACTTGCAGCCGCACGAGTGCCTCTGTAAGCTCAACAATAGTCACGCCGATGCCAACGGCTTCGACCACGCCAAGACGTGCTAGTAAAGCAGAACACAAAC
GCACACACCCGCTCAGCATCTACTTAACAAAGCAGCTTCATAGCAAACCTCACACGTACTCTGTGCAATGGATAACCACCCCCTTCCTTCCGTGTCGGCG
TGAGAGAACGCGGACCAGAGTAGCTCCATGGGGTCGTCCACCTCGACACTTTCGCCAATGTCATCGTTGCTCATATCCGAGCCAAACTGACCAAATTCAT
CGTCCGAgccctcctcttcatcttcgcctGTCAAAGTCTCTTCCCCTTCCTCGACTGTTTCCATGCGCATTTCCTGCGAGGCAGCGACACTTTTCGCTTT
CATCTCTCGTGCTTTCTGTCGGGCCATCTTTTTCCGCGCACGGGTGGCCTTGTAGGCAGCCAATActttcttctgcatcgcTAGCTCCTGTGCAATCACT
TCGGGCTGGCGAGGGTCGACAACCTTGTAACATTCCATGTTCGCTTCACGATCCTTCTGCCACTGCTCCCATTTGGCCCAGCCAAcctgcatctccttca
gctcgtcTGTAGAGAGCGGTTGAATGTGCTGGATTCGCCTCACTGTTGTAAACTGCTGCAAAGGAAATGCGTGATCTGACTCGATGAAGAAATTGGGAAG
GTGCTTCCCAGCCGTCGCTACAGGACGTTGGAGATCCAACATTTCGTCGTGGAGTTTGGGGTCGTTAAAGAGAAGCATTGTCTGTCGAGAGGCATCTCCA
GGTGCACTCAGTCGACGCAGGAAAACGTGATTCCGCGGAGTTAATGGCCCTGTACCGGTTAGGTCACTCATTTGTTTTTTTGACCCCGCCTCCGTGATGT
ATTCTGCAATGTCTCGTGGTCTCAGAACCTCCACTCCCGTGCCATCACCGTTGAGAATGAAAATGTGGGGCTGGATGGGCTCGTTAATGACTGCTTTCGC
AGGAATGCTATCCACATCGTATCGGGCAGCTTCTGTGTCACTCACTACTCCAGCGAGATCAACAGAAATAGTAGGTTCCTCATCTACTCCATTGAGATCC
ACGTGAAATTGATTTTGCTCTTTGTCACAAAGCTGGAACTGACCACGACGGCAATCGAAATAGTAGACACCGTTGTGGGTGGTCACATCtcgatcgtcgt
catccCTAGAGTCAAGTGCACTTGGATCTAATTGTTGCGACCTGTATTCCACTCGTCCACTGTCTTTCGCTACGATGCTTTGACCACTCGGCTTTCGAGT
TGTGACTCGGCCGTTTACCTGCGCCGTAACTTTTGTGTTATAACTGATCTCAATCCTCGTTCCGTCATAAACATTCACAATACTGCGTGCACGTAAGCCA
CCCTTCGTGACTGCCACACGCTTCCCCACAGCATGGCGTTGAGCTGTCATGTTTACTTCCAAATCGATGCAAACGTCGGCAAAGCCTCGCTTCTTTACGA
GTACGTGAGTGTTTCTAGCATTCGTGTACATTCTCGTGCCATCTACGTGATACGTTACGCGCGCGCCGCTCGTGAATGTAACAATTACGACACCGTTGGG
GCGTCGTTCGACCAGCGCATCAGTCTCTGGATCTACCGTGAGAGTCGTAACCAGTGGCGGCTGTAGTTCACTATCAGAACTGGTTCGTTTTCTTGAACCG
TGGCGGTGTTTCTTGCAATCATGAACTACGCGAACGATACCACTTGATAGCATGACTTCTTTTCTCCCACAACAAAGCATCCGTAGCACGCTCCCCGTCC
CGTATATCACACGATATTTCTCACCTTCATCACTGCCTTCCAATCCATGCGGCTCATTCAGTACCAGGGAACTGTTCGCTTCGTGGTCATTATAGCGACC
ACTTTTGCTAACAAATGAGATCTTATGCGATTCCTTCGCAGTTTCAGCATACCGCTGAACAATAGAGCCATCGGAACAAGCACACACAATGAGACCGTTT
GGGAAAGAGTTGGTAGCCGAGATAGTGGGAAATTTGTCCGGCTTCTTCGGcagttttcttcttccttcggAAATGTGAAGAGTAGATTCGTCTTGAAACG
AAGCAATGAACTGAAGCATGCATTCTGACTCCGACTTGGATGGTTTTGGCGTCTGTTCCTTAGATCCGCTGTGCGTAGTTATCCCCGGGCGTAGTCCAAA
CATCTCGCTTAACATTGCAGCAGTTAGTTGACACGGTAGCGCTGCGTTATGAAAAATTGTGAAACTTACCCGTGGTGATAAACAGTGAGCCATGCCAAGC
CACGACAGGTCTGGTAGAGTCGCACCACGCTATGGTCAGCAGGATACATTGACCAAGTTTTATTTCCAACCAGAGCGAGCTGTGCAGCGGACAAAGGCAC
ACATGCGCCTGATGCAGCTTCAGTACGCGGTGTAAGATATTCCTGAGAAACGAGCGACTGACGCTTCCAATCTTTGAATGCTGGTCGATGGCGCACGTGA
TCGCGAGCTACCCAGGATGACAAGTGCACCCGACCAGGTGCTGTTTTCGGAAGACACGCCAACAAGAGTGAATCCGTGGGCGCGTAGTAGCTTGAATAAA
CAGCAGGTGTGTTTTGCTGGAGTACCAAAGCGATTCGTTGCGGGAGAACCGCGCGCGTCAAGTTTTCAAGGTGCGCACGAGTCTGCAGTTTACCCCGCCA
GGGGGTCTCTAACATTTCTTCGACTTGCAAAAGTTGTCGTGTTAAATGCACCGCGGAGCAGCTAAATCGTGGCGAATCGTAGAATGTAGCGAGCTCCGTG
TCGCGAATACTGCGTTCCTGTTCGGAGAATTCAGGCACTCGAGGCATTGATTTCCGTCCTTCGTTGCCTACACCTGGGAGATCACTTCGCTTCCACATGG
CCCTCTCTACATCGTCAAGGCGGTGACttccgtgctgcagcaaacatGGATCCCCCTCTGCATTCAACGCTTCGTGGCAAAGTTGAGCACCCGCCACTCG
ACAAGCAACTAAGTCGCCATGTTCAATGAATTCTTCAGACTGAGATGGGCCCACCTGGTTGTCGTGGGTGATGTTGTACGATGTAGACGACACCACTGGA
GGGAGGGATACCGTTGCCACGGCCTCAGTGATGGCAAAAAGCACCGTGCTGACTGCAACACTACCAGAAAACACACCACGTAGTACCGAGTCATATTGTT
CGTAAAGTGCGCCACCCgcaccatcgtcaccatcaCCAACTGCATTAGGGATCGCAATAAACTTAGTAGACGCTACCCAGTCCTTGAACGCAAATTTTTG
CGCAGCAATCGTCTCTAGAGTGTTGATTgtctcgttctccagctcttcagctCGCTTGGTCCCTGAAGATTCCGTACTGCAGACCACATTTGTGAAAGTA
AAGTCACTCCACTCGATACCCCCCACTTGGGCAGCCTCATGGAAGACCTTTACGACAGCGTTTGCAGTCTGAAACACTGACACCTCTACTGATCCACCTC
CATCCACATTCACATCAAACCTACTTACATTTGATCCTCTTCGGTTTTGGGCCCGAACTTTAGAGATAGCAGGGGGGTTAGCTAGAAGCACCACCCCGTC
AATTAGCGGTAAAAGTGGCAACTTCTCTGGTCCGTCCGTCACTTGAGACGCACAGCCCTCCTCCCCCAGTCGTAACAACGCATCTATCTCCAGTAGAGAG
GAAGGATAATCCACCAACAGGTACACACGTGCAGGTGTCTGAGTAGGGTCAGTCGATTTCTTCTCGTCTTTGTCCTCTGTACGAGTCTGCACTTGAATTT
CTTCTCCTCCCTCTTCTGCAACGGCTGCAGCTGTCTGTTGATGTGCCAGAAATTCTTGCTTGTCTTGACCcacgagacgctggaaggccagcgccaacag
caatggtgtcgctgcaacttgcgccGCTCGTTccttttcttcctccttctctaCTGCAACTACAGCAACCGCGACATCACCTTCGTCTGCTCTCTCCGCT
CTGGTAGCCTCTTCCAGCACTTTCTCCTCGCGTCGCTTGGCCTCCACGTCTGCTCGcgcgatctcctccaactccgCTCGACCCACGACGCGAtacgagc
agctccgttgCCAGCTCGTGAGCTCTGCACTCTCCCGAACTCTATTGAGAAACTCCCTCttggccgccagctccttctccgccgcgCCACTGGTCAGCGC
CACTGCGTGGAAGCCCCACATGGCGGCGTTTCAAGGTCTCCCATTTTTGAaccatacaaactccaagttTAACAAAAATTGTCTCTCAGATCCAGGATCG
GACGGCATGCGACTcgcgctcttgctgctcgctgtGTGTGCACTTGCTTTGGCCGCAGCGTCAGCGACTGCTCCTTGTGACGAGAGGAAACTGGAGCGAG
ACGCTGTGGCGGTCCTGACAGCgaacgtggacgtggagTTGGGCGCCGTCGGGGCGGGCAAGCGCGACGTCGTGGGCTTCCAGTATCTGGTACAGTAATA
AAAGCACTTCAACCGTAGCAAACACCCCCTAACATATTGACTCGATATGCCGTAGAAACCAGCAGAAGCGCTCTTGGCAGCTCAAGCGTTGGCCCATGAA
GATTTCAATCAGGCAGCGACGCAGGTTCAGCGCGTCCTCAAGTACCAAAAGCCCCACGGACTCCTGCCACATCTGGTCTACGGTTCGTCTGTGCCGTCCA
AACTACGATGGATACCCAGCAACCGCACTTTCCACCCAGGACCGGCATTCTGGCGGCAGACACCGTCAGCAAAGGAGACTTCATTGGCGTCATTAAACAC
TTCCACAATCTCAGCTCCGCCGGTGGCTGCTGACGTGGTCTGGGAGATCTATCGCTTGGCGCCATACGACTCGGTGCTTGGTGCGAAAACAACTGCTGTG
AAATTTCTCTGTGGAGTCTACGAGCCACTTaaaaagctgcagaagcactTGTTCTCCACTCGCCGCGGCCCCGGTCCCAGTGGTTTGTTGACTGCTCGTG
TACGTATTGGCTGCTGCATGATTCCGCACGTATGATCGAAAAGAGACTGACATTTGCCCGATAACCATGTTGCAGCACCCTTGGGAGACATTTTCGTCGC
TATCGCCGCACTGGAAAGGGTTTCTAGCCAAATTGAAGAATGCACCGGATTATGTGGAATTTGTTAGCTCTATTCCAACGGAAGCTCGAACTCGCTTTGC
AACCGGAGCGAGCTCTATATTCTCAGCCGAGGACGCAGTGGAGAATCTATACGAACCGATGGTATATCTCGCAGCGCATGCTCATCTCGGCGGGGGAGGC
AACGATATCTACAGTCGCGAATCAGCTATGTTAGAGTCCTTCACCTATGGTGTGACCGACGGCGAGGCTGCTCGATTTGGGGTCGAGGATGTGGAGTTTA
ATGCACTTATGCTGCGATCATCGCTGGGCCTTGTGAACATTGGACGTGTACTTGTTGAACACTCATCCGAGTGCACGGGGTTCACTCTAACGCAAAAAGA
ACTTCTGGCCGATGTGGAAGAATTTCGCTCTTTGACGAAAGGACTCGAGAGAGCTCTCATTGGCAGTAATAACACTCAGGGTCTGTGGAACGCATCCGAT
GATTTTTTCGCCGACTCGAGTAGATTGTCATTGACTGCAGTTCACTCGTTACGCGGATTCCTACCTGGATATGCTGCGGAACTGGATGATGCCAAGAAAA
TGCGCTCGATGAAGCATTTTCTTTCGGAGCCCGGCTCGTTTTCTTTCTTTTGCTCTCAGTTCCCCGCTTCGTTCTTCGCCTGCGCTGAGGAAGAGtcggt
tgaagctgctggatcgATAGATCGCCGCCCAGCTACTACAACATGGATCCTCTACAACTACTTCTTGCAGCGGGGGTTTGCTAGGGTACGTTTAATGGGT
ACTTATTTTTTTTACGATGAAAACATTGGCGCTAATAACGTGGTGATGCTCAGAACAAGTTTCCAGGGCTGGCTGATTACATTCGCAACAAGACAAGGGA
CATGGTATGCGAGGCTACAACACCTATTCAATTATCTTTTTCGTGGTTCCCGCTCTCACTGACGGCGGAGAAATCGCCACCTACAGCGCTTGCGCCAGCA
TACGATTCTCGCAACGCCACGCCAATCCAAGTATTTGACGATGGTTACTTGGGGTCAACtttagctgctgccactcTTCTAAACGTTTTGCTGCCAGCAG
GTATTCTCATAAAGCCATTCAGTGCAATTTCTGCGAGCTCACTCTGCCTATGTGTTCTTGTTGCAATAGTGACCCCAACACCAAGCCCAGATACGCCACC
TATTGACCATCGTATTCTCTCTGTCATTATGTGCGTCGAGTTAGTGGTTGCCTTTGGTGTCGCCATGAGCTGTTTCCTGTTTTCAGTGTATTTTGTAGCG
AATCGACCCCGAGACACTCGATTATCTCCTGGTTCTGCAGCCCGCCGTCGGTCATCAGCTGGTGTCGCTGGAAAGAAACCTCGAGACATGGAATTGGAGG
ATCGTGGACGATTAAGTGCCAGCGGAACAGCGTGGGCAGACAGATATTCGGAGTCGTCGTACAGTGACTATTCTCCTCGCTCTGGGCACGCACCGTATGA
ACTGGAGGAGTCGTTGATTTCGGAGGGAGACGAGCATTATGGTTCCTTTAACGAGGCAGAGCAGCCGCAGACTCCATCCAATTCAGCGTGGAAAGCGGCG
AAGAACGCGCTAGCTGCCATCAGCCCCTGGTAA