Description :
From Genome Similarity Track
Location :
contig_9:24443- 29275
Transcript NameFunction/comments
g2571.t1hypothetical protein

Sequence
4832 bases(100 bases per row)
ATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGAC
CAACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGC
ACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCAT
CGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCG
CAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCA
CTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCA
TGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATT
GTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTG
TCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACG
CAGCCATTTCTGCAGCACTATCAGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTT
CAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGT
TCTGCCTCGTTATCCAAAACATCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTT
TCCTCATCAATTCCGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACC
TCCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGAC
TTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCT
CGTTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAG
CACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAAC
GTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACAT
CCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCT
GTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGG
CGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCC
AGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTC
GAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACG
GTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCA
GAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAG
ATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATA
GTGGCGTTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCT
CTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTGCGCTCCACAGGGTCCATGCAGCATGCATGTCATG
ATTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCA
AAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTT
AAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCC
CATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGAC
TGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCAACGTACCATC
GCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTACCTTCGTTAAGCAGTGCGTCCTGAAGCCCTCGGTACTGATCGGCGCGA
ATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAA
GAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGT
GTCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGGTACTGAAGCGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGA
TCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAG
GATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAA
TGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCC
GGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCAC
CCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGT
GAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGA
CGAACCTTGTCTTCCAGACAACAGCTCATTTTGGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCC
CATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCT
CTCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTACCCTTCGCGCTTCGGCGCGTTCCTCCTGCGTA
AGCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTGCCATCCGTTCTTCAGCACGCTGGTCCTGCGTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCTT
GGTTTACCATGCGATCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTGGGCATGTTGCTCCTGGTTTACTATCCGTTCCTCGGCACGCTCCTC
CTGTGTGAGCTGTGATCGGCGCCGGGCATGTT