Description :
From Genome Similarity Track
Location :
scaffold_11:24440- 25875
Transcript NameFunction/comments
Plaha_PHALS_10650hypothetical protein

Sequence
1435 bases(100 bases per row)
AGGTCGAAGCTCTCATGACATTGAATACAATAGGAACGAGTGGATAGAAAACTGGCTCTCTAGAGGAAGACTGCTCTTCGATCGATAAACTCACTTAATA
TTCCACCGTCTTCATATCATTTCTGAGTACAAGGCTCACTTGGTCGTCGGTGGAGACTAACAATGTATCAGACCTTCCCACTCATGCCAGGATTGCGTCA
ACACCATTTAAATTGGAAAATACGATATAGCACGGCGCTCAGACAAACGTATACATCGAAATGAGAAGTAAGACTTTTCTACGATAAGACCGGTCTCCAC
ATGCGAATAGATTTGGGAAAATAGCTCGTTTGTGTGCGATGAGCTCGAAAATTACAATTCACGGCTTGTCTGAGTATTTCCAGAAGACCGCGCGTGCTAA
TGTAAACATAGTATTAAAGGGGGTGCAGCTGTGGTTTGCTTTTACATTAGATATTTCACAACTTTTATGTATAAAGACAACCTAGTGTACCACGGTGTAC
AGGTATACTGTCGACGCTCTTTTTACTAGCTAAATCATCTGCGTGAAGGACGATGTTGAGTAGTGGAAGGCAAATGCCAAAGTGAATTAGTTAGTAGCTA
CACAATCTACCCTTCCAACATATCTGTATATACCTTCCTGTGTGCCTTTCTTGTTCCCTGTTCCTTGGTAGCAGCCGCTCTCGAGCTTCTCCCTGCGACG
CCCCGNNNNNNNNNNCTCAAAGTCCGAGAGCTTCATATGCACAGCACAGGGGGTCGTGTTTAAGTACCAAAAGTCTCAGTCCTGTTTTCACTACATAACT
TATAGCAACTACACAGGGAGAAAAGATTCCCCATCCAACAAACCCTACCGCGCAATAATGGGTGCAAGACATTACAGTATCAAGTTTGTTCGGTTGGTGG
CACCACGAATATGCGTTCAAACGTTGATTATTGGGAAATTGTGCAACCTTTTTCGACAAACATCCTTTGAACCGCTAACATCATTGCTATGGATCGCAGG
TTCAGTTAGCTATCAGCAATGAATATTGTTGTGCCTTCTTCAGAAATCGCTTTGACCCCAAAGTCCATGTTCTGTTCTGTTTATAGATCATACTCGACCT
CCTTCGCTTCGCGCCTATCCTATTCCGCGTCAGTTGTCATTGTATGTAAAGACGTGCTCGGCAAGTCGAATTTCCTTCGATGCTAACAGAGTGGATAACA
ACAGATTTGAAAAGGGGTATACATCTTAGCTGGAAAATACGCCACCCCATCGCGTGAGTGATTGTCTAAAACTTTGATATGTGCTATGCGGTATCGTCGA
TAGCGTTCTCCTGTGTCCACTATATTCATGGGAATTCACTTTGATGAATTTGACATTCCGTCAGCAAGCGTTCCAAAATTGCTATAAGGTTTAGACTGCC
CTTCTTGCAACCACCGAATAAAGCTCTAATACCGA