Description :
From Genome Similarity Track
Location :
Scaffold_4:24433- 27254
Transcript NameFunction/comments
Albla_Nc14006190myotubularinlike protein putative

Sequence
2821 bases(100 bases per row)
TGTAGTGAATCCAATTCCGCTTCCAATTGCAATTCCCTTGCAACACTCTCACTCAAAAGCTGCTCCAAGTACTTGATACGACTCTGATCTGGCGCCATTT
GTAATGCTTCGCGGATATTGCGTCCTTGAGATCGTTGTCGCGTACGCTCTTCCGCGCCTCGACGGTACCTCTCCACCATACTATGATCCACATCAGACAA
GTCGACAATCAACGATATACAAGTGGCTTGTTCTTCTGTCTCATTGGGATCATCGACATTGATACATTCCGCTCGTTCATTTATCAAAGTCGATGCGTCA
TCATCACTCATATCGGAACAATCGGAAAAGACGGATTTCGTTCGATATTCGTCATAATCGTGAATCCCTTCGACTTCTAATCGCATGGCCGATTCTTCCG
TGTCTAGATCTTCAGTGTACACATTCCCAGCCTCACTCACATTTGATACTTGATCAATGACAGCTTCATGGAGCGCTTCTTCGCCTGGAACAACCATCTC
CATAAACTCGACGTAATCCGGATGACTTTCAGGATCCCATCGAAAGTACATGGCATCCCACAAGACCACACGTTTGAGATTGGCACGAGGATATAAAACG
CGATTGGTATGTTTGTACATTGGATTCAAATACGGAACGGATGATTCCAAAATGGGTGTCCATACGGATTCCGTTCGTTCCCATATCTTTTCGAAAATAC
GCTCACGCTCGGAATTGTATAAGAATGTTCCAAAGAGACCGGAAATGAGTGCGTCAGCGATATGAAGAAGGAACTTTTCGTTGAATTCAAAGCACGATGG
AAATTGTCGCGCCATTTGCCATACGCAATCGAGGAATTGAAGCATTACTGGCGATCGCTCATTCGGTTGATCGGTAATGTCTTTGCCAACACCCACGCGG
TCGGCAAATTTATGACCAAAGGAGCACCATTCCTTCTCGATAAGAATGGAGAAACCTCGAATCGTTCGGTAATATGGATCGAGAATCAGTTGTGCTAATG
CGACGAGTTGTGGTGTGCGATCCCATCCATCACTGCAGTGAACCAGAACCGATGCGCCAACTTCATGCAACACTTCAGCGACACGTCTCGCGCCCGATAA
CACGCGCATCACGTGCTTAAGCCATCTCGTATCTTTGATGGAAAGAGTTAGCAAGAGGAGAGAGAGATGAAGAGAGACGTATGCGTACTTTCGAGTCGAT
TGTGGTAGTGCTTGTCTCCATCTTCGATGCTGCTGGGACTCACGAGCACTAGAAGGAATGTGAGAAAGAGTCAATTTGGTTGGAGAGCATACATTTGAGT
GCATCCAGCGAATCTCTCATTTTGTGGATATTTGCGATTCCAAGAAACTCGACCGTCGCGTTATCGTAGTGCTGCGAGTTTTCCACTCCTAGAAACACGA
ATGAGTCTCAAAGAATTGTGAGTCCGATTCCGCACCTTTGCCTTTTAATCGATTCCCTTTAGTGGCGATTGGTTTTCGAGCGTCGAGAATGTGTAATGGT
GGCGAGATACCCGCACTATTGGCGTTGGCGGAATCGCGATATGCTTTCAAAAGAATGCGATCTGACTCGGATCGATTCCCCGCCATTCCATAATTCGGCT
GACTGGATCGTGCCAAGACGCTTTTATTCACGGGATGACGCCATACAACAACGGGTAATCGAGCTCTTGAACGAAAACGCGCAGATTGAACGAGTTCATC
TTCCGACATTTTCGAAGGCACAACCATTAATTGCGGGTATGTTGGACTGAATCGAAACTTGGAATTCTTCAGTAAGCGCCATGTGATGATTTCTCTGCTT
TCAGAAGAACAGCTGGTTTGTTGTCGAAGAGTAGCAGATCCTTGATGACGAAGAAAGCCCAAGCGTTGGTACTCTGTCACAGGAGAATATACGAGCCATC
CGTCTTCTCTTCTGTTGATTCCGCTCTTTCGATGTTTTGACTTTTCGGCGTGGTAATCAAAGGCAAATAATGAATTGATTTGTGTCGGAGGTTTCATTCG
AAGTGTCAAGAGATTCAACCAGCGAATATCGGGATTCGATGGCGGTTGATCGTATCCTTTCTTCCGTGAATATGCGTCATGCATTGCCAGTCGAATCGTC
CGGAGATCTTTGCACGCGATCAACAGCATAAGTCCGTCTCTCGTGATCAAATCGATCGCAGCTAACGGAAGTTCGAAAGATCCAAATTTCCATGCGGAAT
CGTAAGGTGAGAATGTCACGCGATACGTTGTGATTTTGAGCACTCCTTGTACCGCTCGATCGTTTTGTGACATAACCACCAGATTCGTAACTCGTTGAAC
ATGTTCCAGGACTGTTTCCCCATCTAATAATGTGATCGGATCCTTGATCAGAGTCTCTTGTAAACGCGATCGCATCACACCATCAGAAGCTCCATACGTA
GCAGAAACACTAGTTACCGAAGCTGGTGATTCCGTGACGCCACATGTATTCCTCTTGAGCATCACTTTGCCTTGTTCCAGTACTTCTTGAAATAATTTTC
GATCATCCACACTGTAGAAATTGACTTTGCGATTGACAGATGCATTTCCAGTTTGTATTTTCAAATGTAAGCCAAATTTCGAGTACGGTTTGGCAGTAAT
TGCAGCACACGAATACGTCTCACGACTTTCCTGAGGGATCATAAAGCTGAGTATACGAGCTTCCACATCGATCTGAATCTGCATGGAAGCTTTCTTACTC
CCCAATTTCTCAAACACACTATCAGCTTTTCGCACTGTGAATGTGAATGGCGACATCATTTCCGTCCGCAGTGTCCCAAACGATGCAACATCCCGCGTGT
TAAATCCAAAAAGATTGGAAT