Description :
From Genome Similarity Track
Location :
Scaffold_15:244298- 256584
Transcript NameFunction/comments
g3138.t1POM59712.1 hypothetical protein PHPALM_31514 [Phytophthora palmivora var. palmivora
g3139.t1RAW25021.1 Stomatin-like protein 2 [Phytophthora cactorum
g3140.t1KUF79446.1 Leucine-rich repeat and IQ domain-containing protein 3 [Phytophthora nicotianae

Sequence
12286 bases(100 bases per row)
GCCGTTAAAGGAACCGCAATGCGTGACCAAATCACTAGACGATACAGGGACACACCCCATCAGATGACGTGAGCACGGAAGTGGACACAAAGCCCGCCAG
AGACGCCTTCGGGACGCCAACGCCGCTGCCTCGAGCCTCCATAGTAGGTATCTGGCACGTAATTTATGTTTGTGTATTTTTTTGCTTACCGAAAAAAAAA
TAATTTCAGCTTCAACGTCGTAGAATTTTTGCTCTGCACTCGGCTAAGATGCGGACGCGATGCAGTCGAATACTGACGCCAAGCTCTTCGAGGTCACAGT
CGGTGGCCTGCATCAGGAGTGCGCCATCAATACCTTGGACACGGAAGGTGGCGCCGTAGCTGCCGTTATCGAGCCCCAGCGAGTCCAGGAAGTTCTGTAC
CTCACGCACTCCCCACTGTTCCAGCCCTTTTTCACCTTGAGCCTCGAGCGGCGGGTTCTGCAGCTCTTCGGACAAACCTCCACTGAGTGTTTGCTGTCGT
CGACCAGGGGTTGATAATCCCATACCGCGCTTGTGTTCTTCTGTTCTTGCTTTGGACAGTGAAGCTTTCACGCGCAGCACGAGGTCGTTGCGGACCTGCT
CGTCTTCGAGCAATGCCGCCTCGAAGAGTGAAGAGTACACTCGCTCTTTTCGTTCTCGACGTGTTGGTCCTGGATTGGGAGCTGACTGCCGAAGGTCACT
ACCGGACCTGCGCTGGGCTTTGGTCGAGCGGTAGATGGCCTCTTTGCGCTTGAGTTCGTTCTGACGCTGATACAGGTCCCCCGAACGGAACTTGAGATCG
TTGACCAGAGTGCCGATACGAGTCTGCAGTCGGCGACGTTTATCAGGGAGCAGTGCGTCTTCGAGACGCTTTTGCAGTGCTGCAAGCTCATCACGCATTG
CACCCAACTCGTGCTCCGCCTGCGTGATCAACTCCCAGCTCAGAGCGATATCCTCGCGCATCTCAGCTTCTCGAGGATTGGTTGTGGCTGCTTTGGTGAG
TGGAGCATAGCTTTCATTTTGGCCAGCGAATTGGACTTTTGCTCGTGTGGCGGTAGCTTGTTGCTGCTGTTGGACTGCTACCTCAAGAGGAGCGACGGCA
GCAACTGCATCGCTCTCAGACTCGTCCGATAAATGATCGGTACTCACATGCTCACGATTATCAGAGGATTGCCCGAGTCGAATTTGTCGGCGTCTAGCTT
CAGCCTCGCGTTCACGCAGTAGTAATTTCGATGCTGGGAAGATGCGCCGCATGCTTACGTCACCGACCCAATTGCCAAATAGATGAAGTGCCGAGCCAGG
GTCAGATTCACGGAGTGCTGGATGGTCTAAGTGAAGCTGAGCAAGAAACGGGTTCTGCGTCAGTCGGAGCACCTGCAGTGACTCAAGTAGCTCCACACCT
CTGAAGGAAGCGAGAAAATCGAGGTCAGCCGTCATTTTGAGCAAGTAGTTAACGCCGCGCCATCGGAAGTTCGTGGCCTGCGCTTTTGCCTTCTGCTGTT
GCTGCCACTGCTCAATGTCCTCGACAATTTGCGCACTCACCGAGCGTAGCTGGTCAATGACGCTCTGGAACACAATCGGCGCTTTTGAAATCCCAGATAT
TCGAGGTTGTAGTGGCTTTTTCGCGGCCCCCAGCATTTGCTGCAGGGCCTCGAGGCAGCCCTCGCGCTCGACGATTTTCCTCACAATGTCCAAGTCATAG
GGCTTTTCGAACGAGGCGCACGGTGGGAAGACAAGTGCTACTGATTCACGAAGCGCACTCGAGTCGGGAGCTAACGACGGCATCATATGATACACTGCTG
ACTGAAGACGAATTGCGTGCTCAAGCCACTCACGGCAACGACAACAGCATCAGCTTGATATGGTAGACGGAAATATGCACCATGGCTAAAATAGCTCTCC
GGCATTCTCTGTGCGCAGCACTTCGGATAAGAGTAAAAGGTCTTGGGCAATGCAAACATTCATATACATCTCAAGATTTATAAAAGCAAGCGCTCGTTCA
GGGACTGCATCTTTCCCACGGTTAATGTTTGCTGAAAAGGGCCTGGGTAGTTTAGTAACAAACGCTTAAGTCTCTCAAAACAACAGCAATGCGAATTGCT
CACCCGATAAGCTTCACGCTTGAAAGCACTCGGTAAACAACAAATCTGATCAGTACATATACTGTGGTTCTGGTTTTCACGAGTTTGTTGTATTTTTCAT
CGGTGGAGAGCCGACGGGTGTCCTGCTATCGTGGCGTAAGCTACCTGATAGCTAGCCAGCGTTGCAACTCCCACCCTCTCGCCTTCATATCCATCCTCCG
CCTTCGTAGATGCCCGAAATCCAAAACCCGTCTACTGTCGTATCAGTTTAGTTCTTGGTCGTGTCGGGATCAAAAGTGTCCAAAGTGTACTCCCCGACGT
CACCGTTTTCCTGGTTGCCCGCTTTGGCAGCAACACGAGCCGCGTCCTTGTTGTTCTGCTTCTGGATATTTCCGAAAATGGAGAGCGCCGACGCCACCAT
GCTAGAAGGGTCGTTGGTGTTGGCCGGCAGCAGCACGGTCGTGCCCTCCTTGGCGATGTTGCCAAAGGCATCCACGTACTTCTCCGCCACCTGCAGTGCC
ACCGCGTCGCGGCCACCCGTCTTTTGAATGGCGTGCGAAAGCCGCTGAATGGCCTCTGCCGAGGCGTTCGCCTTGGCCAGGATGGCAGCGGCCGCGCCTT
CTGCCTCCAGCACGGCAGCGCGCTTCTTACCCTCAGCCACATTGATGTACGCTTGGCGTTCACCCTCCGAATCGAGGATCTCGGCGCGTTTTCTACGCTC
CGCCTCGGCCTGCATGTCCATGGCCGCCTTGACACTGCGGGGCGGCGCAATATCGCGGATTTCGTACCGCAGGCACTTGATACCCCAGGCCTCGGACGCC
TGGTTGATGGCCTCCACGATGCTCAGGTTGAGCGACTCGCGCTCCTCAAACGTCTTGTCCAGCGTGATCTTGCCCAGCTCGGAACGCATGGTGGTCTGCG
CCAGTTGTGTGACGGCGTACAGTGGGTCCTCGACACCGTAGCTGGCGTTGTACGGTTCGATGATCTTGACGTACAGCACTCCGTCGATGCTGATGGTCAC
GTTATCCCGCGTGATGGCTGTCTGGCCCGGGATCTTGATGGCTTCTTCCTTGAGCGAGTGCACGTAGGCGATGCGGTCCACCAATGGGATGAGGAAGTGC
AGCCCGGGCGTCAGGACGTCGTGGAACTTGCCGAACCGCTCCACGACCCACGCGCGCTGCTGCGGCACGATCAACACGCCCTGCAAATACCACATATCAA
TTTAAAACGTCAGCAATTATTTACAATACGTGTGTGCACGATTTATCTACAATTGCCACTCCACGTACGATGTTGGCGGGCGTGTCCTGCAGGCGCGGCA
TGCCGCTGTCGTCGAAGGACGAGGCCAGCGCCGGGCGCGAGTTGTGCAGTAGCCGTGTGGCCGTCGGCTGCAGGAACGGACTGGCCGCATGAGCCACGAG
CAGCTGCGGGTGCGACTGGCGGCCGGCGGCGCGCAGGAGCTTCACGGCGAGCATCGCAGAGAGGACTTCCGGTGTTATCGCCAAATGACCACCTCCCAAA
GAGACGTACAGTGCTGCACCTCATTTTTCGACATGAATGAAATCAAGTAACCTTTATCATTGCATTTATATTTAGTTGCAAATACTATCTAAATCGATCT
TGAAATATAGTATTCCGTTCATTTTGGATATTGATCCAGCAACACGAACAGAATTGAAGTACTGTACTTTGTTTGTCCCAGTCACCTGATTGGCTGAAAT
AGCGTCAACAACGCTATTGCGGCCATTTACATTTGCGCGTGGAAGGCCGAGGCCCGAGCTTCTCCCGTCCCCATGAGTCGACGCGCAGGCGGATCGGACG
ACGCGCGCAGCCCCCGCGAGCGCAGCAGCAGCGTCAACAGCGCCAGCAGCAGCTGTGGTGCGGCCCCAGCGGCGTCTCCGCAGTTCGTACCGATCCACTC
GAGGGTGGGCTGGCGCTACCAGGCCTCGATCCCGGAGCTGCTCTCGGCCCCGGCCGACGCGGCCGAGCTGCTGTTCAAGAAGCAGGCACTGCTGCAGCCG
CGGACCAGGTACTGCCCCGACAGGGCGGAAGGTGCGGCCCCAGCAACAGTTTTATTGTTTCTGTTGACAATAGGTGTAACATTGTGGGATTTTATGTTGC
GATATTATTATTTTACAGAGTTGGGGGTGGAACTGGAGAAGTATCTGAAGCTGGCGCGGTCGCTGCGGGACGGTGCGACGTTTGATACGCAGGAGCAGGT
GACAACGCTGGCGTTGCAGCAGCTGCACCGCTTTGACTACAACCCGACGGACGCGGCGTGCTCGTTGTATGCGAGACACACCATCGAGCTGCCGAGGGCG
GAGACGACGGCGAAGACGACAGCTGCAGAGGAAGCCAAAAAGTGGCTCTTGGCATTCTACCGTTGCATGCGCTGCTCGGCGATCGATGGACAAGTTTTGG
AGCAAATGTGCGAGCTGCAAGAAAAAGGGAGGGGTGTCATGCCGGCGACGGAGGCTGGTGTGCTGGCGCGGCTTGTGACCCGGATTTTGACGTGGAGGGA
GCAGTGTAAAGCTGTGAGCAGGGATAAAGTGGATCGTGCAAGGCTATTGCAGCTACTGCACCAAGCTGAGGACATGCAGGTTGACTTGCCGGAAAAGGAA
GCTGTCGTGTCCAGGTTACGGACGTTTGATATTGCGTTGACGCAGCTGAAAGAGGCGCTGGAACGAAGCAGCAAACGTCACCAGAGCAAAAAAGTGGAAT
TGGACGAGCTAAATACGCTATTCGAAGCGGTAATGGCGCCGCGTATCGTTTTCCCGGAAGAAACGAATTTCCGTGCTACCGTCGACGAGGTGAAGGGCCT
CAAGTCCACGATTGAGACCATGTTGGCAGAGGACAAGGTGAGTCTGCCCATTATACGTGATGTGCTGGCCAAGATCGAGCTGGTACCAGTGAATTTCGAG
CAGGAGGTGGATCAATTTCAAAAAAAGATGCTTAGCGCACAGACTTGGCTTGCCAAGGCGCGCAAGTGTATGCCTAACCGCCGAGCAACACGTCGAGCGG
GTGGTGGAGACACAAAGAAAATGGATCTGGAAGTGATCCGCGCGCTGGTAGACGACGCGCCGTGTGAAAGCAGTACCGAAGTATTCGAAATGCAAGACCT
CCTTGAGTGTGCAGACGAGTGGGCTATCAAAGTGAATGAGGCAATAGATGGCGGTGCTGACGTGACGCTCGCGCACTTAAAGGAGCTCTTGGATGAGGCT
CAAGATATTCCTGTGGTCATGGACGAGCAAAAATTCTTAGAGGCCGAAATTTCTGCACGCGAATGGTGCACGACTGCTGCGTCGAAACTGACCTCCCGCA
AGTCTATCGAAGAGATGGAGGACTTGATCACGCAAGCAAAAGCGATTCGGGAACGCATCCATCCAAAAAAGCAGTCGCGCTGGAAACCCCAAGTGGAGCG
GGATATCCACGCCGCAATGGACCAGGCGCGCAAGTGGACCAATGAGCTCCGAGATAATCTTGGCGCCCCGGGTTTTGACAAGTTGTTTGCCTCGTTGCCG
TCGTATATTCCTTCTGCACATTCATCCAGATCGTCATCTTCATCAACAACAAGTGCCGATCGATCGAAAAAAAAATCGATGGATGCAATTGGCAAGCTAA
TCGAGAAATCGCAGGCGCTTGCGATTGACGTGTGCTCATACACTACACCCTTGAACGACCTACTTCTGAAGGGTGTAGAGGCACAAGCAGAGGCGAGCGC
TATTTTGATGGGTATTGGTTGCTTGTCGGGTACTCTCGCCTCTGACACTGCGGTTGATGCGGTCGAAACAAACAGTATGGAAATTGACTCGATACCTCGG
GAGCTAGGAGATCTAGCGCAGGCATCAACTCTACTGGAGCGAATCGATGCATTCCCTTTTACGTTTGAGGAGGGGTTAGCTCTTGCCAGCATCGTCGAAG
GTGAAAAGGACTGGGCAGCGCGTGTTCGAGAATGCATACCTCCGCGGCAATCAAGGAAAAAACGTCTAGCCAATGACCCGTTTACGATGGAGCAACTACA
CGAGTTACTGAACGAGTCGAAGAGATTGCGTTTTCTGTTTCGTGACGAGCTGCGTATTCTTTCGAAAGAGCTCAACGACCTCACGGTGTGGCGTGCGAAG
GCACATGAAGTTGTCAATGGCGAAGTGAGTTCTTCTATCCCAAACGTTGTCGAACGTCTTCAAGCATTTGATCTGCTTGTGTATGACAAGTTGCAAAAGG
CCAAAAAGAAGCTCCATATTGGCGATGTGGTTGTCACCAGCGCAGATAAAGAGAGTAATGTCGATACGGATGTATCATCGGCGCTGCCGAGCGAAGCTCC
GAATGCTATCATTAAAGAGGAAGAAGACAGCGTTTGTCCAATGGATGTCGATGCAGAAGGCCCCAGCAATAGTGCGGTGCCAACGGAGAGCAGTAAAGAA
GACGAGCCAAAAGCAGAGGTTGCTCTTCCTAATGGAAAGATCAACAGTGCAGAGAATGAAACTCAGACACCAGTCGTGCTGGACACGAAGCCTACCAACA
CAAATACTGTTGAGAATGTGAGCATGGGAGTGCTAGAGATACATGCCGATTCGATTATGACGCATGTTCGAATCGAAAGTGGTTGCATGCAGAAGTCGGC
TGCCAAGGATGAGGAGGACAATTCCAGCGCGGACGACGCGAAGACATCATGGATAGCGAAAAATGGGCGGGGTCTTTTGGAACCCGTACTGACCATGGCT
GAGGAAAGCTTTACTGCAGTTGATAGTCTGGAGTTGAAAGAAGCGGAAGCACGGCAGACGGTCGAAGAACTCGTTCTGGCAGGTGATGATGGTGATATCA
CGGAGAATATTACAGATAAATCTGTGAGAGCACTGGAGGTATGGAAGCAACAGCTCTTGCATGTGCAAGAGGAAAGCGACATACTTAGTGTGTCAGCTCC
CGAACAGGATGCTATTATCCTCATCATTTCACTGCTGGAGTGGTTGCAAGGCTCTCGGTCTCTCTTTTACGATGAAATACTCCCCCTCCAAGACCTTGTT
GCCAAGGGTGACAAAATTACTGAAGATCTGCAGGCAATGGAGCCGCTTGATATTCTGAAACCAGACACGTTTGAGACTTTGAAGAGGATGCTTTGGTCAC
TACCATACTTGAAAGCTCATGAAAAGGTGGTGCTGGAGTGGACGGAGCGTGTAAACAAATGCGTGGCCGATAAACACGCGCCTGTGAACGAGCTGCAGGC
CTTGCTGGACAGTGGAAGTGGACTGCTGCTAGAACAAGGTACTTTCAAGATTGTAATGGACGAAGCCAAGAAGGCTAGACTCTGGCTCTCGAAACTAAAG
AAGCGCCTGAGAGCTCTGATGACGAAGGGGGTTGGCCGAATGAGTATGAGTGCGGCACGCTCACTGGTTGAAGAAGGTGAAGACATCGCCATCGACATGC
CTGTCTTTGACTTTTTGAAGGAGCACCTAGAGATCGCAAGTGACTGGGAAAACCGTGTTTTGGCGTCCGGCATTGAGAACGGCCAGGCACGCGTGGCAAA
TTTGCTTGCATTGCTCAACGAATACGAGTGCGCTCGACTGGTGATCGACCTTGACATGCACCGGGACGTTCTGAAATCTGCCACAGAGCGTTACTGCATT
TGCCGCCAACCTTTTGACGGACTGATGATCGGGTGCGATCACTGTGATGACTGGTTTCACGACAGCTGCATTGGCATGTCGAAGGAGAAGGCCGAAAAGG
TAGAGCACTACACCTGCCCATCGTGCACCATTTTGCAGGAGCTTGCGGCAATGCTGCAACATGCGAAACAGGCTGGGCAACAAGGTAGTTTGTGGGACAT
GCACGAATATGCCAAGGCTTTCGAAAAACATCAGGCGAGTGCACTACGCAAGGTTAAGCGAGAGGAAAAGACAGTCGAGCGCACTGAAATGGTTTTGTTT
AGCTGCAACAACCAGATGAACCAGCTGCGAGCGCGAATTGATGATATTGAGCGGGCAAAGGCGTGTTTATCTATCAACCCGATTGCAGGAAATGGTACAC
TTGGGCAGCAACAAGCTCCGAAGCAAGTGGCACCATTGAAGACGGCAACTAGTCAACCCTCAGCAACGACATCATCATCATCAGATGGAGCTCCTGTTAC
GACTGGCGCGCCTGCGATAACCACCACAGCAAGCATGTCGACCCCTGTCGCCGTTGGTACAAATGCACTTTTGCTCGCCGCCGCTGCCGCGTCTACCGCT
GCTACTGCAACGACTATCAGCAAAAGCACAGCTACTGTGAGCGCAAAGGCAGCTGCGACAACGCTTGCTACGGCGTTAAACCGTCAGCAGTATCCAAGCA
TCTTGATCCCTTCTGTGCACGCAGTTACTTACGTAACAAAGGGCGTGCCGGTGGCAAAGGCAGCTACAACGTCTAATGCAGTTGCTACAGCTAGTGCTAG
CAGTGTGAATGGAGTGAAGAATCCGAGTGAGCCGGCAAACGTCTCTACGAAGCCTGCTGGGTCGTCAACAGCTCCGTCCTCGTCGGTTGTAGCTGCTAGT
ACTCTTACCCCCTGCATCCAGAAAACAGCAGCCGCTCCAACTCTTACTGCCACCATTACCACTCCCGCTTCAACTTCAGGAGTCCAATCAGTTCCGGCGC
CACCACTGCTGAATCCGATGGCCGCCACGCTGATGGGCAGTACAGAACGGTTAGCAGCGCTGGTCGTTGCAGGCGGTGTGGAGCAGCAGCTCACAAAGAT
GAAGAACGAGCACACAGAAGCGAGTAAGCAAGTGCTAGAGCTGCAGAGCTCGCTGCGTCTGAGTCGTGATCGGCTGGCAAGTGCCCAGCAGGCGCTTCGC
GAGATCTCGGATATCTTCCACGCCCGGCATCAAATGCTGCCCTACGCGCAAACCTGGGTACGGCAAGCGGTATCATTGCTGAATACGACGGCTTTGCTGT
CTCGTGCTAATATCGACTGCTCCGTGTTTCTACCGCGAGAGTACGCGACAGCGCTAACTGAAATGACTCGTCCTGCTCCAGCATCATCTACAAGCCCGGC
ACCGGTGTCTACTACAAGCATCGATAAGCTGTTCCCTGCTGTGGATATGTTTGCGCGGTTGCTGCGCACCGTCTCGTGGAGTCAAGTCGTGGCGTCTCTC
TTGCAAGAGCGGCCATCACGCGCTGTGATCAGTAACGCCATTGCATATGCTACGGAATACGGTCTCTGGGAAGACAAGAAGACAGTGACGCCGCTGCGCA
GCTTGATCGGTCGCGTGGATGCATGGGTCTCTCGCGCACACAAGTGCATGACCAAAAGTGCAAGCAAGACACAACAGGTGTCGCGATTGAAGTTGCTTAT
GAACGAGTACTCGAAGCTTCCGTTGACATCCGCGAAGACTGCAGAGCCCTTGGACACGTACGTGAAGATTTTAACTGGTGTCGGGGCTAAGAGCACAACC
ACGGGCGACGACGGAGCGCTCACACCTGAGGCAGCAGAAGCTGCTGCTGCTAAGGCGCTGGATGAAGCGATGGTCGGACTCTCTACTTCGTTGGGCATAT
CTGGTGCCAGCGCGACGAAGAAGCAGGCTCCACCACGTAAGCGTAAGGTGTACACTCGGAAAGAAAAAGCTCCAGCTCGCTCTACCAAAAAGGTGAAGAA
ATCTCAGGATGGGGCAGGTGCCGCGGATAAGGCTCCATTATCAAGCCGCTCCGTAAGCGTAAACGTGGGGCCGATGGCCAAGGTAGCCCAGCCTGGTGTT
GCTGTGTCTCAGAACGGCTCGACATGACCATTCGGCATTGTATGAAGGGCATTTTACGAGGATCATCTGTATGAAGGCAGACCAGAATGTAGAAAGTAGA
CCCTCGTGTGCCTTGCGCGCGCAGCGGGGAGAACCAACTCGTGCATCGATCGCGCGAGACAAGGTGGCAGAAAGCTCAACAAATGCAACCCTATTGTGAA
CAACGTTTGGAGACATGCTGACGAGGGCTTTTGAGAGGTGAGCTGTCTGTATTCGCGTGACTGACTTTGTATCGGGTGTTCCTGCAGCATGGACCGTTAC
TGCTGATTCTAACTTCGGGCCGCCTCATCGGCGAGTGGAGCAGCTTGCTGTTGAAGATATTGTGCATCTTCGCCTGCAATGTCTGCATTGGCAGAACAGC
CCGGGGACGAAGCAATCGAGAAGGAAGAACACCAGCTAGATGCTGTTGCCAAGTCCAATGAGGCTGAGGAGGAAAAGCAGATAATGCTGGCGGGCCAAAG
CGATGTAGCACTTCAGGAGAACGGCGATGCTGTAGGTGAGGAGAAGGGGATTGTTGCAGAGGAGAAGGACACGGCATCGAGTGGGGAGGATGGAGAAGTA
ACGGGTGAAGTGACGCCATGGGGTGAGAATGATGCAAGCCAGGAAGCCGACAACGACGCAGAAGATGATGCTGGTGATGACGAAGGAGATGCATGGGAGT
GGCAGCTCCGAGTTGTGCAGCGCATGAGTGAGGGTATGCTGGATCTTACCCTGTTCACGTCGGGTGGGTTTGACTTTGTTGTGGTTCTCAACGTGCAGCA
AAATGAGCTGCGAGACCTGGAGCCGATCGTGGGTATGGCTCGGACGCTGCGCGTGCTAAACGCTTCACAGAATGAGATTGCTACGTTGCCTGGTACCGAT
TTCTGGGGCCAGTTCTGCAGTTTGAGTTTGTGCTTCCTCTCTCAGAACGCGTTAAAAACGTGGGCGGATGTGCAGGGACTTGAAGGCTGTGCAGGATCGC
TGATTTGGCTCAGTTTAGCCAATAACCCGCTCATGGCGCTGATCAACGCGCGCAGCTTCATGGTGAACAAGCTGCCCTTTCTCAAGGCCCTCGACAATTT
CGTGACTACGGACCAAGAAGTCATTCGACATGCTCGTCCCAGCGCTCGCTTTAATGCGCTGGCACCGCGACTAAGCATTGCTCATCTACAAATGCCCCTT
GAGTTCGAGACCGATGATGCCGCTCTTCTTTACGCTGTGGAAACGGAGGCAGCTGTAGCAAGCATATTCGCCGACAACAGCCCCAGCGTACGCGCGCAGA
AGCTGGCGCGGGGCTACCTCTCACGGCGTGCCAACTTCCCACGCTTCCGAAATGTGCGTGAGCTCATTATTCACGTGCAGAAGCATATTCGCGGATTTCT
GTTGCGCCAACTCATTAGACGCCAGATTTGTGAGCTGGTGGCCTTGAATGGCGAGTCAAAGCTGCTAATGGCATCGGTCGCGGCAGGTCACGGACATTTG
TCGCCGTTAGCGCGGCGATCATTTGAGAAGATGCTGCCGCTGATACGTCGCTGGCGAGTGCAGTTCCAAGCCAGAAAACGTGCCGTAGCCATCAAGAAGA
TCCGTTTCTGGTGTCAAATGGTGTACCAGCGGCACGCACGTCGCACTCGTCAACTTCTGCATGACCAGCAAGAGATTTGGATTTACTACACGCCGGAATT
CGAGCAGGAGCTTCTCACTCTTGCAGCACGGGTTGCTCGTCGCGATCCGTACCTTATGACTTTATCTCGTGAAGATCGTCTTGAGCTGCTGAGAGAGCGG
TGTGCTAGATCTGGTGTTAGTGTTCTGCGCGGACCAAATCCAAACGCGAACGTCGTGCGACTAGCTTCAACCCCGAACGGGAGATCCCCGACCCCCGTGC
AACCTAGTTCACCGCAGCGTGAAGAAGACGAAGGGTACAAGTTGTTACGTATGGGACGAGAAGCGCAATCCACACTGGACGAGAGTGACTCGTATTTACG
CCGCGCGGCTTCACCTGGATGGCCTGCACTGATCCGTGCTTTTCCTAGCGATTTTGCCCTAGAGAACCAGTTGCTTGTCTCCGAAAAGCGCTTTCTACAG
CACGATCTGGAGCGAATTGCATGCATCCAGAATCAACACCGACAAGCTGTCGCCAAAGGCGAAAGAAATGGCGACAAGTCCCCGACAAGGCTACAGATGA
TGCTGAAGCTCCAGTCACGTGCGGTGCTGCTTCACCTCACACAAGTCACGCGTGAGATTCGGCAACGGCTGGTCATTTGCAACCGAAAAATACTGAGTGC
TTGTGTGAAGCAGCAACAACGTCGACGTAAACAACTTGGTACTGCAGCTCATTTCTCACTGACCAAAGCGAAACTGCGTGCCCGAGGGCATGCTCCTACC
CGATGGGAGCGGAAACGGCTAGTCTCATCATCAGTAGAAAGCCCGCGTGACTACCGGAAGATGAAAGTGTTCATTCCGTGGACCAT