Description :
From Genome Similarity Track
Location :
Scaffold_266:24426- 26072
Sequence
1646 bases(100 bases per row)
CATGTTCGGAACATTTGTATGAGGCCAGTTGAAGTGAAGTAAAcggtcacttcaacttgctcaaATCTAAAATTTGAAACGATTTTTTTTCGTTGTAGGC
TATCAGGGTTAAGACCATTCAGGAAGGAGCGAAACAACAAAAGTTCAATTTGAAGGACTTTCTtaaaagaaaaaaaatacaatAACCAGTATTCTGAGTT
TTTCCTAGCGGAATCGTTATTCGAGTGTTTATTTCCTAGCTAAGTTGGAAGTTCCAACTTGGAACAGTAACACAAATATATTTCACGAAACAAACACAGC
TATTTTTTCATCTCTTGTGGCAGGGGGTTACTGGAGCGTTAATACTAGATAATTTTTTGTCTTTGTGGTACTGGTTGGTTATTTTTAAGCACGCGGAATC
CAAAATACGGTTCTTTTTGACCGGATTTAACGGCAGCGGATAAAATGTAAGTAACTTAATTACTTTGAAGCACACCCGTTGCGACGGCATCGGACGTCTT
GCTCTACTGCATCCACTTAAAGTGTACTAAGTAGAACATCTGAACTGTATTCTTTGCGCTCAAAGATATCTCGTTTTGTTTGATTCCAAACCGTAAATGa
tttctacatgtagtattcGGGCAATGTTCTCGAGAGCTTAATCTGCGCAGGCATAGCTGGAACCCATTAAAAAGTGGTTAAAGTACATAGCTCATCAAGC
AGCCAAGCACCGAAAATTTGTCAAAAAAATAACAAAAAGAATACTTTTGGATTATTCTGTTTCAAAGTAAATAATCGCCTCAAAACTGTTAAGGAAGCTG
AACGAAGAGATCCACCACGATAAATCCACGCGTCCCACGTGAAAAAGCATGCCTTGGATGGATTATTTTCGAAGCTAATCCGAAAATCCATGGTAATTAA
AAGTCCTTGTGACAGTTGCCGTATTGTTAATGAAGTCTTTACCGTGGGCTCAACCGGCACGGAGAAGGCATGGTGGTCAGTCAGCCTGGCTGGAAATGTG
TGATATGAGCGCCCAGGTTCTTTCATCCTCTATTTTTCACTTTTCCTATAGCGAGTGGCCATCTTGCGCTTCCGCTTGGCTGCGATAACACACTTCTGTT
TGGCTTTTCCgtgtggaagcagcagtgtaTTGAATCAACAATAGTATTGATTGCTTCGACGGCAGGTAAGACTTGGAGCCAGTGGCTCGGAGCCACAGAC
TGGCTGTCGAGCACTTCAGGATTTACtctcaaggacgaggagtacAAGAACTAAAGCTTCGTCATAGTATACTACAAACTTCAACGCGTTAAAAGGGTCA
TCTTCTTTAGTAACTTAGAAGTAGTGCCGATCAATTATTACCAGTCCggtaaagaagaagaaaaaaaatgaatCGAGCCCATTGAAATTTTGAGTAATTT
CTATTATACTTCGTATTCTACAGTACTACTTCTTTAAGTATTCAAGAAATCAAGATCAAACTCACAAGTGATGCTCATGTTGCTggtcgtaagttacgac
agAAGTACGTGTAGATAAAGCAAGGTGACTAACAATGCAAACCGaactcttcgtcttcgcgtTGGTTGCTCGTAATAGACGCCCGCCTCACAGCGAGCAT
AGTGAACCTACGTGCATATCCTCTCTAGCCCTTCCCTCCgaaatga