Description :
From Genome Similarity Track
Location :
Scaffold_88:24424- 25489
Sequence
1065 bases(100 bases per row)
TCAATCAGCGTGGGGAAGGGCTACTGGGGTATGCGCAAGGTGGTTTATTTGGGACATCGGGTGTCTAAAGATGGGCTATAGGCAAATCCGAAGGATCTGG
CCATGTTAACTGATGTTGATTTCCCGGGATCACTTCGGGCGATGCAATCGCTCCAAGGTAGTTTGAACTACTATAGTCGTTTTGCTGAGGACTATTCTTT
CTTTGCGGCTGTACTGTACAAACTACGAGAAGTGGATTTTGCGGCTATAGCCAAGTCATACGTCCGGATCACGATCGAACAAATCTTGGCACAGACCTCA
ATTCGACGGATCTGGATTAAGTGTCCGATCAGAGAAAGGCAGTCGTAAAATGTGCCTAATCCGGATGAAGAGACCCCCGACGGCATCCAATCTCGGTGGG
TCCGAGCGCATCGGATGTTCACGACGTTGAAGGGCAAGATCGCGACAAGTCCGATTCTCTGTCATGTCAATCGAGATCGTCAAGCCGCGCTAATTACCTA
CACCAGTAATTGGGCTATTTCAGCTACGCTAGTGCAGGAACATGATGGGATGTACTATTCAGTCACTTTTGTCAGTCGAACTCTCAAGCCAGCTGAGTTC
AACTATGGCGTGGTGGAGAAAAATCCATCGCACTTTTATGAGATCTCGATCTTAACAACAACTTGCTTGCGGGACGATCCATCAGGATCTTGACTCGACA
CTCGACCTTGGCCTGGCTGATCAATCAGTTGGCCTTCAAGAACGTCTATGTCAGTGAGCAGCCCTTCTCTCGCCTTGGTCTTTGGAGATCATCAAGTGTA
CGCATGGGGAAGACGAGATCTTAGGTGGTGTTGCGGCGATTATTACGCCAATATCCGAGGTAGACGAAGTGTTTTGACCCGGATCGCGCCCAGCAAAGAG
CCTAGACGCCCGATCCAAACTTTGATTTCGACAGTACGACTGGACGAGCATCTGTACGTGTTAAGTTTTGACGGATCCGCCCGCGTGAAACGCGGTAAGG
GCGCTTACAGCGCGATCTTGTGGAAACTACCAGAATGGACGGTGGCTGTAACGGGGTACGTAGCC