Description :
From Genome Similarity Track
Location :
Scaffold_115:2442- 9544
Transcript NameFunction/comments
Phypl_g3454hypothetical protein
Phypl_g3455hypothetical protein

Sequence
7102 bases(100 bases per row)
ATGGCCACGGCCGCAGACCCcgctgcggcgcgcggcgcgccgtggcccttgcgctgctccggCGCTACGCCCTTCAGCGGCGGAATGCGGCTCGCGTCTG
ACTCTTTGGGGTCTTggttgtcgccgccgcccttCCGGAAGAACGCCACGAGGTCGGCGAACACGTCAAAGCTCacctacagcagcagcacagaaCAGCA
GTCAGCTCACCAGCTGATCGACACGACGAGCAAGTACGGCGGCCGCACATTGAACGGGTGGGAGATATTGAACCGCACGAGCGCCTCTGTGAGCTCGCTG
GTCGTCACGCCGATGCCTAACACGTTGACCACAGCCAGTCGCGCTGGAAACAACCAAAGGCGCATGGGATTAGTACTCTAGCGGATCAATCAATTGCTGC
CAACCAACACGAGAGCACAGCTAACGTACTCTGTGCGACAGACAGCAGACCCCTGCCTTCTGTGTCAGCTTGAGAGAACGCAGACcagagcagctccatg
gggtcgtccacctcgacaGTGTCCCCAACATCATCGTCGCTCATATCCGAGCCGAACTGAccgaactcgtcgtccgagtcccCCTCATCTTCGCCCTCCC
CGCCCAATGCTTCCTCACCCTCCTGAACGGTTTCCATGCGCAACACTGGGCTCATTTCCTGGGAGACACTCTTCGCTTTCATCTCCCGTGCCTTCTGTCG
AGCCATCTTTTTCCGCGCACGGGTCGCCTTGTACGCAGCCAAAACTTTCTTTTGCATCGCGATCTCCTGGGCGAGCAAATCGGGCTGGCGAGGATCCTCA
ACTTTGTAGCATTCCTTGTTCGCTTCACGATTCGCTTGCCACTGCTCCCACTTGGCCCAACCAACGTGCATCTCGTTGAGTTCATCTGCAGATAGGggct
ggatctgctggacACGCCTCACTGTCGTGAATTGCTGCTGTGCAAATGTGCGTTTTGGCTCAGCAAAATAGCTGGGAAGATACTTGCCTGCAGTTGCTAC
GGGCCGTTGGAGACTCAGCATTTCCTCGTGGAGATTGGAATCGTTGAAGAGGGGTCGAGAGGCACCACCCGGTGTACTCAATTGACGCAGGAAAACATGG
CGACGTGGGGTCGATGAATCTGTGCCTGCCACGTCGCTCACTTGGATTGCCGATGCCGCATCCTCAATGATTCCTGCAACATCTCGCGGTCTCAGAATTT
CTACTCCGGTACCATCGCCGTTGAGGACAAAGATATGGGGCTGAATCGGTTCATTAATGACTGCTTTGGCAGGAATGCTATCCACGTCGTATCGAGCGGC
TTCACTGTCACTCACTTCTCCAGCGAGGTCAACCGAAACGGTGGgtcctgcttcttcgtctgaTCCACTGAAATCCACGTGAAATTGGTTCTGCTCGTTG
TCGCACAGCTGGAACCGACCATGGCGGCAATCGAAGTAGTAGACACCATTGTGGCTTATCACATCTcgatcgtcgtcgtccttaGAGTCAAGGGAGCTCC
GATCTAGGGAACTGTATTCCACTCTCCCACTGTCCTTCGCCACGACGACTTGCCCACTAGGTTTACGGGTTGTGACTCGGCCATTCACCTGGGCCGTAAC
TTTTGTGTTGTAGCTGATTTCGATACTCGTCCCGTCATAAACGTTCACAATGCTTCGCACACGAAGACCACCCTTCGTAACTGCTACAcgttctcctgca
gcatgGTGCTGGGCTGTCACGTTGACTTCCACATCAACGCAAACATCAGCAAAGCCTTGCTTCGTCACGAGTACGTGTGTACCCGCAGCGTTCATGTACA
TCCTCGTGCCATCCGCATGATACGCCACGCGAGCACCACTCGTGAAAGTGACAATAATGACACCGCTAGGGCGTCTCTCGACCAGCGCATTGGTCTCTGG
ATCTACTGTGAGAGTTGTGGTCAGTGGAGTGTGAAGTTCGCTGCCATGACCGACTGACTTTCTCGAGCTGTGGCGATGCTTCTTGCAGGTACGAACGACG
CGAACGATACCACTAGCTAGCAAGACTTCTTTCCGCCCGCATCGAAACACCCTCAGCACGCTTCCCTTTCCGTAGACCACACGATATTTCTCGTCTTCAT
TGTTGCCTTGGAATCCATTCAttgctcctgcagcgctggtCTCGTCGTCTCCACGGCTGATTTTGCTACCAGCGACGGAGTTGTTACCCCATTCCTTTGG
AGTGTGAATATACCGCTGAATGACCGAGCCATCAGAGCAAGCGGACACGATGAGGCCGCTTGGGAACGAGTTGGTTGCCGCTATTGTGGAAAATTTGTCG
GGCTTTTTCGGAAACTTCCTTCTTCCCTCAGAGATATGAAGCGTAGATTCGTCTTGAAATGATGCAACAAACTGAATCATGCGTTCCGAATCGGCCGCAA
TTTGTCCTGGTCCTTGCTCCTCGTAAGCGTTTTCTTGACCTGTGGCGTTTGTCATTCTCTCCATTCCCGACCGTAGCCCAAACGTTTCCCTGCCAAACGT
GCATGAATTAGATAAAAAGATAGCACAACACGAAGTAAGATATAAACGCACCCGTGATGGTAAACTGTGAGCCAAATGAACCCTCGAGGGGTTTGATATA
GTCGCACCACACTGTGATCAGCAGGATACATGGACCAAGTTTGAGTTGCCACGAGTGCAAGTTGTCCAGCAGACAATGGAACGCATGcccctgctgcagc
ttcggtgCGTGGTGTAAGATATTCTTGGGAaacgagctgctcacgcttccagcacttgAATGCTGGTCGGTGACGCACATGGTCACGAGCAACCCAGGAT
GACACTTGCATCCGACCAGGTGCGGTTTTCGGGAGACACGCTAATAAGAGCGAGTCTGTGGGTGCATAGTAACTTGAATACGTATCGGGTGTGTTTTGct
gaagcaccagcacgatTCGTTGTGGGAGAATGGCGCGCGTCAATTTTTCAAGAAATGCGCGAGACTGCAACTTTCCCCGCCAAGAACTTCCTAGCATTTC
TTCGACTTGCAAGAGTTGTCGTGTTAGATGCACCATTGGGCAGCTAAATCGTGGTGATGTGTAGAATGTTGCGAGCTCCGTGTTGCGAACACTACGTTCC
GGCTCAGACAGCTCTGCCACTCGAGGCATTGCCTTCCGCCCTTCGTTGCCTACACCTGGTAGATCACTTCGCCTCCACATAGCTCTTTCGATGTCATCAA
GGCGGTAATTGCCGTGTGGCAGGAAGCATGGATCACCCTCTGCTAGCAATACTTCGTGGTTTAGTTGAGCACTGGCCACTCGACGTGCGACCAAGTCACC
ATGCTCAAGGAATTCTTCAAAGTGGGATAAATCCGCCTGGTTATTGTGACTGGAGTTgcatgatgaagaagatgatgatgTTGTCAgagaggaagaagtc
gcAGACACGGCCGCGGTCATGGCAAACAGCACGGTGCTGACTGCAACACTACCTGGAAATACACCGCTTAGCATCGATTCGTACTTGTAGTAGAGCGCGT
CACCTCCACCTTTTTCATCGCCAGAGGAACTAGGAATCGTAGAAAACTTCATTGCTCCCACCCACTCCTTGAACGCAAATTTCTGAGCAGCAATCGCCTC
TACAGTGTTGACAAGCTCCTGTTCAAGCTCCTCGGACTGTTTGATCACTGACGCCTCCGTACTGCAGCCCACATTCGTGAAAGTAAAGTCACTCCACTCG
ATCCCGCCCACCTGGGAAGCCTCATAGAACGCCTTCACGATAGTATTCGCGGTCTGAAACACTGAAGTCTCCATCATCGAGATTTTTGGACCGCTTCCGC
CCACTTTCACTACAGACTTCCGTGGGAGATTGGTTGTGACGCTTCTGTTTCGACCCCGAACTGGTGATACGCCCAGCGGGTCAGCCAGAAGCACCACTCC
GTCAATTAGCGGCaagagcggcagcttctccggCCCGTCGGTCTCTTGCGATGCACAGCCAACCTCTCCCAATCGCAGCAGTGCGTCTATCTCCGGCAGA
GAAGAAGGGTATTCCACCAGCAAGTACACGCGCGCAGTCGTCTGCGCTGGATCAGTCGAATTGCTCTCGTTGTTCTCCGCTTTCTCCTCTGCGTTGTGCG
CCTCTGTCTGTAGATTGGCGAGAAACTCTCGCTTGTCCTGACTCACGAGTCGCtggaaggccagcgccagcagcgagggcGTGACTGCAACCCGcgtggc
ctcctcctgctcctcctcttctGTCGGCGAAGCtgcgtctccttctcccGCCTCCTCAACCCCGACAGCTTCCCCCAGTGCCTCCTCTTGGCGTCGCTTg
gcctccgcctcctccgcaTGCGTCACtcgcgccagctcctccagctccgcgcgcCCCACGACGCGatacgagcagctcctcgtccagccCGCGAGCTCTT
CGTTTGCCCTGACCCTGTTCAGCAGCCCCCtcttggccgccagcgcatCCTCCGCTGCgccgctggccagcgccaccgcgtgGAAGCCCCAGCGCCTCAT
GGCTCCGCGTCGTTTGAAGCTCAAGGTGGAAGTTGTCCCGCTTAAGTGCGCTTCTATACAAACTCCCACTTCGGCGGTTTGATCGCGAGCCACTTTCGGA
AAGAGGACGGCGGCTCTCCATGCGACTCGCGtgtgtgctgctcgccacgtgcgcgctcgctctggcggcggccgacgcccCGTGCGAcgagaggaagctg
cagcgagatgccgttgtgctgctggcggcccacgtggacgtggagctcggcggcgtcggggCGGGCAAGCGCGACGCGATGGGCTTCCAGTATCTGGTAA
CGAAGGACTCATCCACCCCATTGAAAGGCTTCACCTGAGCCCCGCAAAAAACACTGACTGAGTCTTACTACGGCGGCGCAGAAACCTGCTGAAGCTCTAT
TGGCAGCGCAAGCTCTGGCTCACGAGGACTTCAaccaggcggcggcgcaggtcCAGCGCATCCTCGAGTACCAGAAGCCCGACGGGTTGCTGCCGCACTT
GGTCTACGGACCGTCGGTTCCGTCCCATCTGCGATGGATCCCAAGCAATCGCACCTTCCATCCAGGCCCAGCCTTCTGGCAGCAAACGCCGCAGCCGGAG
GAGGAGCTttcgacgtcgacgttgaACACCTCGACGATCTCGGCTCCTCCGGTGGCTGGCGACGTGGCTTGGGAGATTTTCCGACTGGCACCGTACGACT
CGGTGCTGGGAGTGAGGACGACCGCTGTGCAGTTCTTGTGCCGCGTCTACGAGCCactgaagaagctgcagaagcatGTGTTCTCCACACGCCGCGGTCC
TGCTCCCAACAGTTTGCTGACTGCTCGTGTAAGTATTTATTGTGAGATTACGACTGGTGCACAATCGTTTGCGCTGGAAACTAATGGCTCATGGGATTCA
TgatcacctgcagcacccTTGGGAGACCTTTTCGTCACTGTCGCCGCACTGGAAAGCATTTCTGGCCGAGCTAAAAAACGCTCCTGACTATGAAACAGTC
GTCAGCTCTATTCCCGAGGAAGCTCGAACTCGCTttgcagctggagcaagcACCATCTTTTCAGCAGAAGATGCCGTGGAGAACCTATATGAACCTATGG
TATATCTCGCAGCACAAACCCGTCGCGGAGGAGGCAGGGAGGGCTACAGCCGTAAATCAGCCATGATAGAGTCCTCCATCGCGTATGCTGCGGGTGGCGT
CGAGGCAGCTCAATTTGGAGTCGAGGATGTCGAATTCAATGCACTTATGCTGCGATCATCATTGGGCCTTGTGAACATCGGTCGGGTTCTCGTGGAGCAC
TCGTCCGTGTGCACGGGCTTCACTCTAACCCAAGAAGAGCTTCTAAATGATATGGAAGAGCTGCACTCGATGGCCAGAGGGCTTGAAGGGGCTCTCATTG
GCAACAACAACACTCGAGGGCTGTGGAACACATCCACAGACTTCTTCGCTGACTCTAGCAGATTGTCATTGACCTCCGTTCACTCTTTACGCGGATTTCT
ACCTGGATACGCTGCAGAGCTGGATGATGACAAGAAGATGCGTTCGATGAAGCATTTTCTTTCGGAGCCTGGTTCGTTCTCTTTCTTTTGCACTCAGTTC
CCGGCTTCCTTTTTCGCGTGCTCGAGGGATGCCTCGTCCAAAGTTGATGGGTCGATGGATGGTCACCCTGCAGCCACGACGTGGATTCTCTACAACTACT
TCCTACTGCGGGGTTTCGCTAGGGTACGTttacattttttttttaccgTTCACGATAAACACGCCGCTTACTAACAGTATTGTAATGACCAGAACAAGTT
TCCAGGACTAGCCGATTATATCCGCAACAAAACGAGGGACATGGTATGCGAGGCAACGGCACCTACTTGGCCGTCTTTGTCATGGTTCCCCTTCTCTCTG
ACTGCGGAGGAGCCCGCTCCTACGGCTCTAACACCAGCCTACGACTCTCATCGTGCTACACCGGTCCAAGTTTTCGACGATAGCTACTTGGGATCGACGC
TGGCTGCCGCCACTCTTCTAAATATTTTGTTGCCAGCAGGTATGCTATGCTATCTACACTGCCCCCTTCTGCCCAATTTGTGATAGCTAACCCAGACTCG
GTGGTCTCATGTATCAACAGTGATCCCTCCGCCAAGTCCAGACACGCCACCCATTGATCATCGTATTCTCTCTGTCATCATGTGCGTCGAGTTAGTGGTT
GCGTTTGGAGTCGCCATGAGTTGTTTCCTGTTTTCTGTGTATTTTGTGGCGAATCGACCTCGGGAAACACGGTTATCTCCTGCATCTGTAGCTCGACGAC
GATCATCTGCTGGGACTGCAGGAAAGAAGCCTCGAGACAAGGTGGATCGCCGCAGGGAGGACTTGGAGGACCGCGGGCGATCAAGCGCTAGTGGTTCATC
GTGGGCAGACAGATATTCAGAGTCATCTTACAGTGACTACTCTCCGCAGTCCGGGCACGCACCATATGAGCTGGAGGAGTCGTTGATttcggaggaggac
gagcactATGGATccttcgacgaggccgagcagcgtCAAACTCCGTCTAATTCAGCGTGGAAAGCCGTGAAAAAAGCGCTGGCAGACATCAGCCCCTGGT
AA