Description :
From Genome Similarity Track
Location :
Scaffold_391:2442- 8339
Sequence
5897 bases(100 bases per row)
AGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACC
CAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCTGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCCGCGCCACGA
GACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCTAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCTG
CCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAA
CCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTG
AACTCGTCCTCGGGCATGGACCAGGCAGTCCTAGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGG
TGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCTTGCC
GGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTG
CGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGTGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGA
CGGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGTCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGTTACTA
CCAGATCCTGATGCGCGAGAGCGACATCCCACTTACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAAC
GCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCAACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCG
AGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGT
GTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCA
CCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATC
TCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCC
GGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATC
TCGTTCCAGTCCAGGCAGCTCAAGGCATCCCAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTCC
ACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGTT
GTCATTCTTCACGGAATACAACTTCCGTGTCGAGGACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCT
CATATTAGTCGGGTCACGACGGATCTGTATGAACGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGACCGCTGGCT
CGGAAGCCAATGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGA
TCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGGAG
ACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTACCAGCGCGTGAAGCCTG
CCGGTCACGCCTCGACACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCG
TGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACATCGTCACTGGCGACAAGGTCGCTCGCCTG
TTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCC
TTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTAT
CTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTAC
CTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTAGGGGAGAGGCTCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGATAGGT
CGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACG
AGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCTGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACC
TGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTTAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCAC
TACCACGTGGAACGAGTCGTCCGGGAGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCG
TTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATGTGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGG
GGTACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCTTGCGCT
TGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGAATGGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATA
CCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTTTTCCACCTCGCTCCAGATCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGT
CCACCCTTGTCCTCCGCCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTTGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAA
GAAAGAGTGGCTCTTTCTCAACAAGGGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGC
TGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGTCCCGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGTCTG
GCATACGCACCCGAGCTAGCCGCGTGGTATTGCTGCTGTTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAG
ACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGACAGTCGC
TTTCGACGCTTGTGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCG
GCCACGACCCCAGCGTCGGCCATAGCGACTTCGTCGTGCGACTGCTTGATGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCT
TTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGCCGTCGGGTGAACT
CTCACCGGTGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCG
GCGTCAGGAGACTTGCTCCGAGCCCCTGCCTAACGGCCACTCTCCAGCGTGCTGCTACGAGAGCGCACTACCTCCTCGGCCGCCTTCGTGGCCTCCATCA
GCGCGGACGGCTCGTCCTTGGCCTTGACCGCCCTGGTCTTTGGCCCTACGGCCCGCGGTTTCGGAGGTACTTTCGCACTGCGCGCACTGCGCTCTGGAGG
CATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATACGCCAGTTGCTCTATGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTC
GATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATCGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGT
TACATGGAACAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAATTGGCCTTAGAGCCAACAGATACATTTTGT
ATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGT
CGTCCCCTGCAGACCAGGGACACGTGAACGACTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTATGTTAAGGAGTGCTGTGTGCCCCGTCACACA