Description :
From Genome Similarity Track
Location :
scaffold_180:24417- 25849
Transcript NameFunction/comments
Pl_108168conserved hypothetical protein

Sequence
1432 bases(100 bases per row)
CACGCTTGCTGCCTCCTAGACTCACCAGGGCGTAGCAGTCCAGCGACATAAGATGTGTCTGCAACTCCTCGCGAGACAAGCGAGGTACCCACGCAGTCTG
CGGCAAACCACGCAGTCGTGCAAGCTCTTCACTTACTCGGTTCATATCACATTGCTGCAGCGATTGCTTGGGGCTGCTGTTGCCATTATTTTCGTTGCTA
CCCGGGGCAAGTTCCGTGATCACGTACAATAGTAATTTGGCTTGTCTAGGTAGCTGCTTGATTTGTTGGACAACCGGTGACGACAGCATTGACGTCGCAC
ACTGGAACACGTCACGCATGGTGACTTTTAGCTGCGAAGTAGATGCACTCTTCTCCAACATACCGGAGCGCTGATGAGCACGACGAGCAGACTGTTGCAG
CAAGCTGATAGCAAGACGAGCGTCACCATCACGAGCTGCTACCTTTCTAGCAATAAGCTCAATCGCACGCGGTTCAATGAACTTAGACACTTCTGTCACA
TCCGCATTTGACGGCAACGCACTTTGGACGTAACTCTGCATAATCATCAGCAGATCGTGGTGCGTGTATGAGCCGAAAACAACTCGAGGAACGTGCGACT
CTGCTGCATTTTCCCCAGTTACATGAACGCGGGAAACCTGCTCATACATGTCGACACCATTCATAATACCCAAGAACTTGATGTCATGAGGGGCGACTGC
AGCCCACCGCACGAAAAAATGAAGCACTTCCTTCACAGCTGGCTGCATGCGCACAGGCAAACGAAGTAATTGATCCACTTCGTCCAAAACCACGACGATC
GAGTGTTTCTTTGCTCTTGATCCCTGTCGTTGTAATCCAACGAACTTGTCCATCTCAAACGGGTCTAGCACCACGGGAACTTTCCAGCTCGTCACCTTTT
TCACCAGCTGCGCGACAGCAGCGAATAAAAGTGCGGGGTCCGTGAACGTGCTACAGTTAAGCTTCACCGCAGTTTTGTTGCTCTTCTTCTCGCGTTTTCT
CTTCATTGTTGTCACAGCTTCCACTGTTTCATATCCCTGTTCGATCAGCAACTCATTCACCGACGAGCTCTTGCCTGTTCCTGGGGGCCCAATGATGAAC
AGACTCGCGCCCTGCTTCGCATCACCCTTCAGCACGTCACGGACGACTTGATGCTCCTCCACACGCCCAACAATTGGCGAATTAGCACGCAGCATCTGCC
CTGAGATAACCCTCTCTAACACTGTTTGTGGGTCATCTACGGACTTTGACTCTGCAGAACTCGAGTATTGCAGCGTTCTACACAGAGGTGCGCGTTTAAC
GAGGGTTGTCTTCGTCTCTGCAGTCTTTTCTGGGGTCTCGTGGATGCTCATAGTTGGTGTACGAGGCTTGGGATGGTGCGGGGTCAGCATTAAAGGGGAG
GCGGAGACGTCATCGGTCTTGCGCTTCTTGGG