Description :
From Genome Similarity Track
Location :
contig_71:244123- 246734
Transcript NameFunction/comments
g11940.t1hypothetical protein
g11941.t1hypothetical protein

Sequence
2611 bases(100 bases per row)
CGCGTTTTAACTGAGCCAGAACGTCCTGCAGCTCCTCCACCTGGTCACGTAAACTCGCCAGCTCTGCACGTTTCCGTCGCTGAAGTCCAGTCGACGAGGT
CTCGGCACTTCTCACTCGACGCTTTTTCAAAGGTTTTGACGGTGTGTCGTCTCCCTTCTGCGGAATTTCTGGGGCCGTGTGTTGGTCGCTTGCTGCCGGG
ACATCTGGCAAGTCGAGCAAGTCGTCAAGCAAAGGGACGTCGTCCAGGGCGCTGCTCTCGTCCGTCGTATCGACCGAGTTCTCGCCGCTGCAGGCCTCGA
TGAAGGCGAACGCCTCGTTCAGAATAGACTTGTTGTCGTCGGCCTCAAAGAAACTCATGCTGAAATCGGTAAATGGCGATCGGGAGGGAGGGAGGTCGGC
CTTGATTACGAGTCTGGCCCACACCCATAATCTACTTCGTGAAGCGATTTTGATTGGATAAAGTTTATTCCCACCCAAACCCAGTATTACACTGCAGAGA
TCTAAAATATAAATGAAGTTGTATTCCCGGCGCAAGTTGGAGACGATCGTCGAGAAACACGAGGCAGATGTTTGATGTTGCAATGATATAATTATGCACG
CTAATTCCCTGAGAAAGGCCTCGACTTGCCCTATCAATGTGGGCGCTACTCCCTAGACACTGACGGAGAAATCAGGGCCGTATCTTCGACAATTCCATTT
GTGTTGACAACAACCACAAACGAAAAACAACACTACAAATACGGTAAATTCCAACATTGCGATAGCCATACCATAGCGGTATCGACAGCATATCAACTCT
TATCGAACAGTGTGACTGGTCGACCGTTTCAGTAGGCGGGTATGGAGGCGGGGCTCTGCTGTGATGACTCGGTGCAGTTGGCTTGGATCCTCTGGAAGTT
CGACCACATCATGTCGCCCAAATGCTGCAAAACGAATAGCTCTGTTGGGTCTGTGCCTTGCGCCTCAAAATCCGACAGCGAGTACTGATCTGAGTTGATT
TCTGGGGTCAACCGATAGTGCGACTGCAACACAGTCCCCGTGGAGGACCTTGTGACTAGAATAAAACCCTCTTCGCGGAATCTCATCGCCGTATTCGTCG
GGTGGTCACACACCAGCGACGAGAACGTGAATAGCAAGCGGTTTTCTTCCTCGTGACACCGAGACAGCGACAACGTGCTCAGCTCGACAGCCATGTCCTG
GTCGCGCAACTCAAACTCGGTTTCCTTCTTCGTCCCCTGCTCAGTCATGTATTTCCTCTATCAAAGCAACATAAAAAACGTTAATCAACCACCTCAAGTG
TAACTTTCATCTCAAAACTCACGTAGTTGTTGTAGTGGCATGCCTTCAAGTCCATCATCGCCTGCTCGGTCTGTTTTAGATCCAATTGGGTAGCCATAGC
AGTCCTTAACTCGACGTACGGCATGCCCGTCACCGCATCTCGTCTCACTTGAACGCCGGTCGAAAGGTCCTGTACCAGAGTGTGGTCCAGCGACTCAAAA
GTCGTCGTGACATCCACGTACAACCTGCCCAATCTGGCCGAAAGTTCCCCATAAATGGCATCGTTCAAATTGGGCACGAAACCCTCAAGCACTGAGGGCA
TCGTGGGCAAAGGCGTCCTCAATGCCTCTTCAATGTGCACCACCGCCGTCACATTGCTCAAAACCTCCTGCACGGCCTGAGCGACTTTACTTTGTCTGGC
CAGCACATTTTTGAGCTCTTTGTTGCGGCCTTCACTCCGTAGTCTCAATTGCTTCTCCAACTCGGCCTTGTTCTTCCAGAGCTGCGTCACCTTGTGCTTT
TGGGTCGTATCCAGCTTTTGACCCAATTCACGGCTCGAAAGTGTCCAAACGCTTTTTAGCAATTGGGTCTTTCAGCTCTTTCAGTTTGGTCTCCAGCGCC
GTCACTTGGGCACGTAGGGCTAAAAATTGGGCTTTTTTCTTGTGCTGGCACCGACGCGAAGCTGCGGCCTTCCGCGTCTTGCGGCGGTCCTCGGAGCTCG
GGGGAGGCGAGTTCTTGCCGTCGTCGCTGCTGCTGCTCGTTGAGGTCGTCGCGTCGCTATCGAACGTGTCGATGAAGGCCAACACGTCCGAGAGCGTGGG
CTCCAGCTCGTCCAGCGGCAGGAAGCTCCCCATTTGCCCAATTAAGGACGAATTGAAGAATGAGGAATGACTGTACCGGTATCGTGTTACCCATTTGCGA
CATGCAATTCGCTTTAGTGTCTTTACGACTGGAAACAGTAACATACTTGCCATTTGTGCAGAGGAATGTTCCCAAGTTTTATCCACGAACTATAAGCAAG
TACTATTTCGTAGCAATGTGCAGGCTCGTATCATCACTATTAGAACGTTATCGAGGTCAAGTTGCCTTCCTCGTCAATTTCCAGGCTGTCCGTCGCAAAT
ACATCGTCCAGCAAAAGCCTCTCCATCATACGCTCGATTTCCTGGTTGTCTTCAGCTACTGTTTTCACTGACAAATCCATGAACTGGCCCAATTTCTCCT
TCACTTCCTCTCCGCTCTCTTCAAAATGCATGGGCGTTAAGCGTATACAAGCCTGAACTAGTGTCGAAGCAAACTCAGCGTCATTTGTTGGTGCGTGAAC
GACGCACCATC