Description :
From Genome Similarity Track
Location :
Scaffold_22:244055- 249611
Sequence
5556 bases(100 bases per row)
ATTGTGATTTTCATATGGAGAACAGTCACGACATCATGTCTACTCTCCACTTGTATAACCTGGCATTCCGAGTGATGATTGCCGATGGCCATCCGCTGGC
GTTTCATCTTCAATCCGAGAAGCCAGTCTTATCGGATATTATGCTTTGCCTCTCGTATGCATTTTATACCTGTGATGAGAATACCCAGCCGCTCCCGGAG
CGCGAGGGTGCTATTAGAGTGATTTTCGATTCAAACAAATATGATTACATTCACAAGACGCTGCGTGAAACCCTAAAATCCCATTCGGCAGCTGATCATC
ATCAAGACTAAGGATTACGATGAGTACCTGTACGACCTGTGCTGCTTGCTACCGCCTAGATTCCTTAATTAATTAAGCTATTAGAGTGATTTTCGATTCA
AACAAATATGATTACATTCACAAGACGCTGCGTGAAACCCTAAAATCCCATTCGGCAGCTGATCATCATCAAGACTAAGGATTACGATGAGTACCTGTAC
GACCTGTGCTGCTTGCTACCGCCTAGATTCCTCGATGATCGCAAGAACTTGAACAACTATACTCGCATGCTGTACCAGATGCCCGGTAAGGATGTTATGC
TCATGCGCCGGACGTTTGCTGCGATTATGAGTTTCCACCATGGTGAATACTTCAGTGAGACGGTATCCATGATGTCATATGACACCGATGGCCCCAACAC
TAAGTACCCCCAGTCGCGATGGATATTGGTAAGCTCAAGGCTGCCGCCGGAGGTGCCAACACTGATAAGTACAAGATCTGGAAATCTACATATGAACCTG
ATCCTATCGAGGCAGATGATGCTGAGAAGACCGGCTCAAAGAAGAAAACGGCTGTGATTTTGAAGGAGAAGATTATCGATATCGCAAAAGATACATACCG
ACGAGCATTTTCTACAGGTACCATTTATGAGAAGAAAACAGCCTACTACTACGTTCGTAGATTCAACGACCCCAAGGAGTTCCTTAATCACATCTTTCTC
GATAATGGGATGTATCAGATGTGCTCTCAGTCAGAGCATAAAGAGCTGCTCCATTTCATCAAGGACACAGCTCGTCCAGAGTTTCCATTCATGAAGATAG
ACCATGATTTCATGGGATTTAAAAATGGCGTCTACAGTCTGAAGGATGCTTCATTCAGCTCAGGCGACGATATTCCAAAACATATCCAAGTGCGTGTGTA
TTATGATATTGATTGGGTTATCATCGATGATACACCTCTACTCGACAAATACTTTTCATATCAGTTCGATGATGCAGATGTCATCGAGTTTATCCATTTC
ATGCTCGGACGAGCTCTGACTAAGATCAACGACAAGTTTGATTTCATGGTCATGCTTGTTGGAGTTGGCGGTTTTGGCAAGAGTTTGCTGCTTAATTTGA
TTTCCTATGCATTCGGCCCTGATCAAGTAGGAACCCTGGGAAACAGTTTTCAGGACAAGTTTGGGTTATCCGAGTTAGCTGACAGGCAGATTGTGCTATC
CGAAGACATGCCTCGCAACATCGCTAAGACGCTACCCAAATCCGATTTCCTGTCAATGCAGAGTCGTGGTCGTATTTCATGTCCTGTCAAGGGCAAGACC
TCTATCGAGGTTGACTCGTGGGATATCCCCACTCTTATCAATAGCAACGACCTTCCCAATTATTCCGACACCTCTGGTGAGATTGTACGTCGTATCCTGA
TCCCACACTTCACCAATGTCATCCCTGATGAAGAAAAGGACAATCAGCTTGAAAAGAAAATCAAAGCGTCTGAGTTTGCAACATTCATTCACAAGTGTCG
GTCGACGTATTTGAGATTCTGCAAAGAGCATGCTGGTCAGAATGTCTATACATTTGCTCCTCAGCACTTCATTGACAGCCGAGACATGCTTCGCGGTTAA
ATCAACGAGAGCTATCAATTTTCTAAGGCTCACATCCAATATGTTGAGCCAGTCAAGGGGCAAGAGCCATGCAAGATCCCTAAGGCTGACCTCACAAGAA
TGTTTCGAGCATACGTCAAGGAGAAATACAGCATGTCCAAGTCGCCTAAGCAGGCCATGGACGTTCATTCAGTGGTTAGCGCTGATCCTCGTATCAAATT
CGTTGCTGAAAACATTTGCAAGTCATGCCGCAAGAAGCATACTGCGAACTGCTGTAGTGAGTACTCGCGCGGCAACCGATCCAAGGCTGAGTACATCATT
AATGCCAGATACTCGCCAAACCAAATTGGTGAGTGATGATTAGACATCGTCCACTTGATTGTATGTATATTTTTTATCTCTGAACCCAATCAGCTAATTT
ATTTTCTATTTAGAGGTTGGTGAGTGATGATTAGACATCGTCCACTTGATTGTATGTATATTTTTTATCTCTGAACCCAATCAGCTAATTTATTTTCTAT
TTAGAGGTTTGTCTCTATATTATATATTCCTGTCCGACTTACCATGCTCACCCGCGACGACTTCATCCAATTCTCAGCACCGGCAAGCGCGTCGCTGCGT
CGACCCTCAAGAACAGAGTTAATTTTCTATTCAAGCAGTATCGCGACATCGGTGGAAACGCCAATGACCTCTCATATCTGAACAGCTACTCGAATGTCAT
TCGCCACATCAACGAGAGCAAGAACGCTGAAGGAAAGAAAACATACCTGTTTCACCCTCTAGCGCTCGCTAATACGAAGGCCGCTCGACATGTCGTCAGT
GATGATGCGAGGCAGAAGCTTCAGTCAGCAGCTAACCGCGCTCGGGACAAATCCAAGAAGGACTCTCTGAACAATGTCGCAACCGACAAGCAGCAGCTAA
CCGCGCTCGGGACAAATCCAAGAAGGACTCTCTGAACAATGTCGCAACCGACAAGCAGCAGATCAACTATCTCAGCATCGATGGAATGACTATGCAGCTT
GAGAAGCACATTCACGAGTTATTCGCTAGCTATGATATGTCTCACAAGGCCGCCAAGATCAGTGATGCCGACTTTGCCAGATGGGACATCCAGAGCGATC
GTAAGAACATCAAGAGCTTCGCCCGCGATCTCCAGCGATGCATGATGCTCGCCTGCTACGTATATCAACCTGCTCTACGCGCTGATTGGTGTACGCTGAA
GATCACCTCAGCCGCTGTCAATCGACTAGATCCAAAGCTCAACTGGATCCAAGTACTTCGCGGAGGTCGTATCCGATTGCATATGAACGATTTCAAGAAC
CGTAAGACCTTCGGGGCTCATATCGTCGAGATTGAAAACATTCACCTCAAGCGTTATCTCAAGTACTGGATTGATCTGCTCGGAAGACTGCTCGGATCGA
AGCCTGAGCATCTGTTCATATATCAGCTCAGCCCTGTCAAGGATGTATCGCTGATCAGTACTAATAGAGATGCATTCCCGAAGGCTGTTTCTCGAAACAG
TGAGAAGGTCTTCAACAGACCTCAGACGATCAATAGCTTCAGGCATGCTTGGGAGAAGAAGATTCAGGAGGATCCAGCCTATCAGCGCATGACTCAAGCT
GAGCGCCAGGAGCTACACCACAAGCTTCTCCATGGTGTATTTACTGGCCAACTGTATAACTGGCAGCGGCGAGGATACTCTGACTAAGCAAAAAATATTT
TTTTAGATTGTAAGGCTCTTGAAGTTCCATTTGGTATCCAGAATCGGTTCTACTTTCTCGAACTCGCTTGTCAGCAATCGTTTGAGCTCGGATCTGGCGA
TCATGACTCTTTTGCGAGATCAGCAATTTTTTGTGATTCAACCTCGGCATCCTCTTTGATACGGTATTGTCATAGACTCCGGATGTATCTAGATCTTCTG
AATCGATATATTCAATTTCGTCCTCCATCGTAAATTTATGTGATTGAGTATATATATACGATTGCGATAAAATTACGATGACTTCATGCCGAGCACTCAC
TAAAAGCGACACCCCATGCTCTCGCAATGCTCTTAAAATCGGATACAGTGCTCAGCACGACAAGGATGCTAAGATTAGAATGTACCGCAAGGAGCTATCA
AAGATGCACGAGCGCGTTCGTCGATATTTGGAGATCACTAACGAACTCAACGATAAGCTCTCGATCATCCAAAAAGTTGATTTCTAACAAGTCTGAATTG
ATGAAGATCGGAAGCCATGATAGACCATACAGAGGAATCATAGATAGCTCGTTCTACAAGGCCGAAATTGAAGATTTATTTGGCATGAAAGCTTCTGCTG
CTCATGATGAGTATGATAGACTGCTTGCGTTACGGAATCAATTGGTCCATCCACATACACTAGATGGCAGAAACGGCTCTAGGACGGGGGCTTTGCCCCG
CGTCAAAAATATGGGTTTGCGAAAACGATATCAGGTAGACTATAAAAGAACGATGTTTCCATCATTCAATAGCCTATCTGAGCGAGAGCGCAAGCGCCAG
GAGCTACTGCGCGAGGCTGAACGCGAGCTCGCTATCGATAGGCATCTATCGCATAGATATGCGGAGACCTTGTGGGCAGCCGATAATGAAGCGATTACTA
TCCCTCTAGCCAGAACTACTTATGGAGTCAGCACGCAAACCGATGGTACGCAAGCAGCATCTACCACTACGACGTCGACCGACACGACACCACCAAGCGA
ACTAACTGGAGATATTAGCATTCCAGCAACTGTATCATCTACAGCTGCCTCAGATATGGTTAATCTAGATACTGATCATATCATGTATCGTCCCGATGCG
TCGATGGAGGAGGCTGTGTCCAAACGCGAGGATAGACAAGCAAAATCATATCAGGCTGTTGTTGAGCTATTAACTAACATGCCGGATGTTGCTACATGGG
ATCTCCATCCGCTCTTCGATCCGATGCTAGTCAAGGACGGCAATGCAAAATCTCAGCGTGATTTGTTCTTCCTCGGACCAGGTGCTAAGCTATACCATCG
TAGCTCTCGGCAAGCTGTACGTAAGGACAAACAGGAGGATTTGATTGAGCAAATCGACTGGGAAGCTACACTCGAGTACATCCTTGATCGTATAAGATTA
GTTGATGGCTATGTCAAAGCGCGAGATCTACGGGAAAAGCTAGATACTCAGCGTAAGGTATTCGATGGGCTCAAGCTCAATGCGGATATGCCAAGATTAT
TTGAGAGCTTTAAAGCGCTCAACTCAATCAAGGATGAGATTGTGCGAGAGGACAAGCTTGATAGTAATCGATTGGGAGAGTCTCGCTTAGCATTGAACGA
CATGGTGAATCAGATAGTCAATGAGAATCTATCGAGGGTTCGCGAAGCGATGATATCAATCGCGATTCGAAACAGATCTTTACCCAGATCGTGAATAGCA
ATTGGAATGTTATCAAAGCTAATTTATTGCATGATTTCAATGACAAACAAGGTTTCTATGCGCTGGGTCGTAGCGACGATCTGCAAGGATTGCCTCCTCC
AATCGATGGATACTACATCGATCCAATCAATTTTAAGGTTCGTCAAACACGTAATCATCGAGTATCGAATAATATGGAGAAGGAGCGTCTGTCATGGGCC
AATACACTTCAATTCCTATTCCAATCGGCTCAGAACCGTGATATCGTGCTCGATAC