Description :
From Genome Similarity Track
Location :
contig_71:244054- 248468
Transcript NameFunction/comments
g11411.t1hypothetical protein
g11412.t1hypothetical protein

Sequence
4414 bases(100 bases per row)
TAGATAAGCGATGCCCGCGCGTTTTAACTGAGCCAGAACGTCCTGCAGCTCCTCCACCTGGTCACGTAAACTCGCCAGCTCTGCACGTTTCCGTCGCTGA
AGTCCAGTCGACGAGGTCTCGGCACTTCTCACTCGACGCTTTTTCAAAGGTTTTGACGGTGTGTCGTCTCCCTTCTGCGGAATTTCTGGGGCCGTGTGTT
GGTCGCTTGCTGCCGGGACATCTGGCAAGTCGAGCAAGTCGTCAAGCAAAGGGACGTCGTCCAGGGCGCTGCTCTCGTCCGTCGTATCGACCGAGTTCTC
GCCGCTGCAGGCCTCGATGAAGGCGAACGCCTCGTTCAGAATAGACTTGTTGTCGTCGGCCTCAAAGAAACTCATGCTGAAATCGGTAAATGGCGATCGG
GAGGGAGGGAGGTCGGCCTTGATTACGAGTCTGGCCCACACCCATAATCTACTTCGTGAAGCGATTTTGATTGGATAAAGTTTATTCCCACCCAAACCCA
GTATTACACTGCAGAGATCTAAAATATAAATGAAGTTGTATTCCCGGCGCAAGTTGGAGACGATCGTCGAGAAACACGAGGCAGATGTTTGATGTTGCAA
TGATATAATTATGCACGCTAATTCCCTGAGAAAGGCCTCGACTTGCCCTATCAATGTGGGCGCTACTCCCTAGACACTGACGGAGAAATCAGGGCCGTAT
CTTCGACAATTCCATTTGTGTTGACAACAACCACAAACGAAAAACAACACTACAAATACGGTAAATTCCAACATTGCGATAGCCATACCATAGCGGTATC
GACAGCATATCAACTCTTATCGAACAGTGTGACTGGTCGACCGTTTCAGTAGGCGGGTATGGAGGCGGGGCTCTGCTGTGATGACTCGGTGCAGTTGGCT
TGGATCCTCTGGAAGTTCGACCACATCATGTCGCCCAAATGCTGCAAAACGAATAGCTCTGTTGGGTCTGTGCCTTGCGCCTCAAAATCCGACAGCGAGT
ACTGATCTGAGTTGATTTCTGGGGTCAACCGATAGTGCGACTGCAACACAGTCCCCGTGGAGGACCTTGTGACTAGAATAAAACCCTCTTCGCGGAATCT
CATCGCCGTATTCGTCGGGTGGTCACACACCAGCGACGAGAACGTGAATAGCAAGCGGTTTTCTTCCTCGTGACACCGAGACAGCGACAACGTGCTCAGC
TCGACAGCCATGTCCTGGTCGCGCAACTCAAACTCGGTTCCTTCTTCGTCCCCTGCTCAGTCATGTATTTCCTCTATCAAAGCAACATAAAAAACGTTAA
TCAACCACCTCAAGTGTAACTTTCATCTCAAAACTCACGTAGTTGTTGTAGTGGCATGCCTTCAAGTCCATCATCGCCTGCTCGGTCTGTTTTAGATCCA
ATTGGGTAGCCATAGCAGTCCTTAACTCGACGTACGGCATGCCCGTCACCGCATCTCGTCTCACTTGAACGCCGGTCGAAAGGTCCTGTACCAGAGTGTG
GTCCAGCGACTCAAAAGTCGTCGTGACATCCACGTACAACCTGCCCAATCTGGCCGAAAGTTCCCCATAAATGGCATCGTTCAAATTGGGCACGAAACCC
TCAAGCACTGAGGGCATCGTGGGCAAAGGCGTCCTCAATGCCTCTTCAATGTGCACCACCGCCGTCACATTGCTCAAAACCTCCTGCACGGCCTGAGCGA
CTTTACTTTGTCTGGCCAGCACATTTTTGAGCTCTTTGTTGCGGCCTTCACTCCGTAGTCTCAATTGCTTCTCCAACTCGGCCTTGTTCTTCCAGAGCTG
CGTCACCTTGTGCTTTTGGGTCGTATCCAGCTTTTGACCCAATTCACGGCTCGAAAGTGTCCAAACGCTTTTTAGCAATTGGGTCTTTCAGCTCTTTCAG
TTTGGTCTCCAGCGCCGTCACTTGGGCACGTAGGGCTAAAAATTGGGCTTTTTTCTTGTGCTGGCACCGACGCGAAGCTGCGGCCTTCCGCGTCTTGCGG
CGGTCCTCGGAGCTCGGGGGAGGCGAGTTCTTGCCGTCGTCGCTGCTGCTGCTCGTTGAGGTCGTCGTGTCGCTGTCGAACGTGTCGATGAAGGCCAACA
CGTCCGAGAGCGTGGGCTCCAGCTCGTCCAGCGGCAGGAAGCTCCCCATTTGCCCAATTAAGGACGAATTGAAGAATGAGGAATGACTGTACCGGTATCG
TGTTACCCATTTGCGACATGCAATTCGCTTTAGTGTCTTTACGACTGGAAACAGTAACATACTTGCCATTTGTGCAGAGGAATGTTCCCAAGTTTTATCC
ACGAACTATAAGCAAGTACTATTTCGTAGCAATGTGCAGGCTCGTATCATCACTATTAGAACGTTATCGAGGTCAAGTTGCCGTCCTCGTCGATTTCCAG
GCTGTCCGTCGCAAATACATCGTCCAGCAAAAGCCTCTCCATCATACGCTCGATTTCCTGGTTGTCTTCAGCTACTGTTTTCACTGACAAATCCATGAAC
TGGCCCAATTTCTCCTTCACTTCCTCTCCGCTCTCTTCAAAATGCATGGGCGTTAAGCGTATACAAGCCTGAACTAGTGTCGAAGCAAACTCAGCGTCAT
TTGTTGGTGCGTGAACGACGCACCATCCTGTCTCGTCCAAATTCAAACCAGAGAACTCCTCATCCGCCTCTGAAAGTGAACGCCACACGATCACGTGCCG
GGATTTCTCGATGTACCGTCGTGCTACCTGGTAGGTCTTCAGGGTAAACACCTCCCCGTTCCCTCGCTCCAGAAAGGAACAAAACTGCACCGCCTTCGAG
TTTTCCGAGTCAGGCAAACCATCGTATTCGTGCCGCTCGTTTTGCCTATGAGGTGCGCAGGATAGCTCCAAAACTGCATCACTAGTCCTTCGGAAATCGA
ACGGGATCTTCCCCACCCCAATATTCTCAAAGCACTCGGTCACTCCATTCAGCTTCCTTGTCGGTTCTCCACCTAAAATCATCCCTGGCGTCGTGTTCGT
CCCCACCTCGGCAAATACCTCGTCTACTTTTTCGTAGAGAGTGTTCAGACTCTCGGCGTAGGTCTTGTAGAGCGTTGCGTCTTTTGCCTTGGTCCGTGCC
TTCTTCTCCCCCAAAGCGTCTGAGACTGCCTCGACCACCTTGTCTGCCTCTCGAAGTCGCTTGTTCAAAATACTTTGAAAGTCCTTGATCATAACAGCCC
GACTGTTAACTGCAGCACGAAGCCTGTTTTGCACGTCTTCGGCCTCCTCTCTCCTCTCGTACTGCTTCATTGCGATTGCTCTCCACGCTCCAACAGCCAA
GGAATCTCTGGGTCGAGCTTGTGTTTTTTCTCGGTTCTTACGCTTCTTCAGGTTTGATAACCGTTCACTCAACTCCACGTCTTGTTGGCGTAAAATTGCC
CATTCCACTTTGAGTCTGCGTCGATACGCGTCGCGTCGCTGCCCGGCCTTCTCTCTGGCAATGTCGCGGTTGGTCTTGTTCGCTTTTCCAGCGTTTGCAC
TTGCAGAGGTGGCACTTTGAAGTGGTAGAAGCAAGGCATCCATGTCCGCTAGAAGTCGCTGGCCGTCTAGTTCGTCGAGGTTGAGGCCGCTGTCATGCGT
TGCAGGAATGTCTTGGGACAGAAACCCGTCAATATCGCGCAGGAGGAGCTGGTTGTCTGTCATCGTCAAGGAATATCGGCGAGTGAGTGAGCACTGCTCA
CTGCGAACAGGTGAGTGAGCGCTGCGGGATACCGCCGTAAGAGCTGGAATCTATACCGGATACCGGTAGAAGTTTCCCCCTCCTCCTAACTGTAATAGAG
CACTCCATACGATATCCCGTGATCATGCGTGCCATCATCAGGTTTCTCAAGATTTGCCGGCCATGAAAACTTCGTGGGCCTTCTGTATCGATGACGATCG
TGGTTCACCTCTGAGCATTTGTTTTCCATGATTCATACGTACACTTTAGCTTGCGTCCACGAGCTCACAGCTCAAGAGTCATTCTATAGTTCACTTCCTC
ACTCCAAAATACTCGATGATATCGCTGTTTCTTGCCCGAGAGCCAGGGATTGCGGGGATGTTTTGCGTCATGCTGGGAGCTTCAGTGGCTGCACTTCTCA
AAATTGGCACTTCGGTCTTCACGATCTCCAAGGTGTCGCTGGACACGCTCGAGGTAGCCGACGGGATCGCCAGTGGCGATGTTGAATGGCTGCTGTCAGC
AGTGGAGGCGTTTATTGACGAAGTCATCTTTCCCATTCTCGGGCTCAGCCCTGCCCAGCTAAGTCGAGCAAATACACTCTCTCACGTCTAAAGTGCTACT
GGTGGACGTAGAGAGTATACCAAACGTCAAGCATCAACCCCCGACGATCAAGACTGAGTGACACATCGCGGGAGCTGGGGAAAGGCGTTTGTTGTTGACA
TGCAAGGCGGATCA