Description :
From Genome Similarity Track
Location :
Scaffold_31:244013- 248828
Sequence
4815 bases(100 bases per row)
GAAAAGAAGGGGAGAATCTCTTCCTGTGAATCAGAAAGGTGGAAATGGACATGAACTCTGCTATGCTCCGGTTGGAGCAACAGTGAGTTGGTATGTCTAT
CTCAAAACAAGGTGGTCGAGCCAGAGAATGGGCTCTCACGTGTAGCACGTCAGTAGATGAAGCTTTCCCCGCATGAGATTTGCTAAAACAGCAAATATCC
CGGGTGTTTGCTCCGCCTAATCAGGCATACCAAGTGAGTTCTCGTTTCCTATCTGCCCGTAAGGGCAAGAAAGAACTATCAGTCTATGTCCGGAACTGAG
AACTCTAATAGCGTCCATGCATCTTGATCCCTTACCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCCTTCGTACGGGCGTGGCTCGAACGGAGGTA
TTCCGGGTACACCCCACCTCCTCTGAGGCGGCTTTGGATATCGCATTGAACGCTGAGATCAACGTTAAGGCAGCCCGTTTCGGCACCCATGGATACAACC
CAAACTCGGCGAGCTCATTTAGTTCATTCAATAGGCCATAGCCTATGGACATCAGTCTCTCTGAGACGGACGAAGAAGAATATCTTCGAGCTGTAGAACA
GCATTGAAACATTCGACGATGTTTCACGTGAGAAAGCACAAATCATCTGCGACCTAATTTCCCTCTACGCAGGGCACGCCAGGATACTTCAGGCAGAACT
CCCGCCGCTAACCAGAATTCTGGTACAGTGCGGGTAAACGTAGACTCCCAGTAGGCGCGGGGCTCCCTGCTGGCGAAACTAGGTTTTGTTGAGCCTCTAG
TAGATAGTGGCGAGTCGAATTTAGCTCCAAGGAGTCCCGCGCACTCTAGCACGTGGCGTGAATACAAGCCATGCTTGTTGGTCGCAAAGCCGACTGTTAA
GGGCTTTGACAAACTCTGGTCGATTTTGATCGACTCCGGAGCATCCGGTAATTTAGACGCTGTTACCTTGGAGGAAATCCACGTTATGTTGAGGCGCTAC
AAGTACACAAGGGTGATATGATTACTGTTTGCTTAGCGACAGGAGCTCTGGTCACCGCACCCAAAGTTCCTGTGAACTTGGGTAAGAAGTTTCTCGATTT
TGATAGTATCGAACGCTGTTTAGTCCTTGATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGAGCCATTGATGGACTGG
AGGTCAAAACATTAGGCCTCACGCACACTACCCCTAGCAGAGCTTTGGAGAGTCATGAAACCACCTCTGCTAGGATTCAGAAGCGTTTTTGGCGCGAGCC
ACTGGCTGACAATGTAAGTGTGCTGGACATCGGAATATCAGATTTAGTTGATTCTGACGATGTCAAAGACATGCGTATAGAGCAAAGCTCGATATGTGAT
TGTGAAGCGGCACGTACTCCGCTAAGTGATAGTAGTTGTGAGAGAAACGTCCTGAATGCTGAAAGCATTGTTGACCAAGCGTCAAGTCATCAAGGGTTGA
AACCATCAGACGAGCGTGGAGTGGCACGTAAGTAACCATTGAGTGATGTTGGCTGTGATAGCGACGCGCTTCATGTAAATATTGACGTTGTTGATGAAAT
ACCGAGGCATCCCGATCCCGGCTCAGCGGATGCACGTGAAGTGGCACGTAATCCACGTGATGACGACGTCATGTCAAATGACTCGTCATCGGATGTCGAT
AGTGACGTCAGCTCTAGTTTAGAGCAAATTAAGCTCGATGATGGTATCGATCAGAGAGATACGAATCACACATCGTGTGCTGTGTCACAAAGCGATGATG
ACTGTCAGCTGTATACACTCGTCAACGGAGTGGATGGTGCCTGTGATGGTACAATTAGCCTTGAGGGTATACTCTCGTTAAGTTCGCTTTAGAACTCGAA
GAGTTGTCGGTCGATGAGATTGATCACTCACTAAAGAAAGGAGACCTTTCAGAGATGGTGGTCATTCGACCCGACGTCATAGGGTTGAACTCTTCTTCAC
TTTTGGATGAAGTCGTACTGGAGGACACAAAATCAGCACTCAGTGCGCGTAGTGGGTCATCAATATTGAAAGACCCACATGATCCCTTTTATTCCTTAGT
CAAGGAATTTATAAGATATGGTGGGTGTTCCACGATCCACCCTCTGTTCTACCTCCAGATAGAGGTGTCTGTCATGAAATTGACTTAGTTCCTGGAACGA
AACACTGTGTCACACGACAGTGGACCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTCTTCCGTTCCAAGCACAAAGCAGGAATGGAACGCGAGAG
TAAACCCATACATCCGACGCCAACGATTTGTGTTGAAAAGCCAAACGGCAAGTGGCGTATTGTGCATTCTTATAACAAGCTTAATGCGACTACGATTCCA
GCACACACCCATTCCTCAAAAGGGTGTTCTTCTAAACAACATGGTTGGCTGTACTATGTATAGCGCACTCGATTTGGTCGATGGATATTATCAATTTCTC
ATGCGAGCGAGTGATATTCCGCTTACAGTAGTGAGCACCCCGAGTGGTATACTATGGGAATGGCTGGTCATGCCCTAAGGGCTGTCTAATACCCCAGAAA
CATTTAATCGTCTGAAGCACCTTCTCCGCCACATCGAGAATACGCACAGACGTACTTTGATGACATTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCA
GATATTGACAACCACATCGGTCATTTGCAAGCCGTGCTCGAGTGCATGCGCACTAATACATTGTACGCCAACGCGTCTAAATTCATTTTGGTGCAGAGGA
GATTCCTTTTATAGGATGTTTCATTGTTAAGCGTGGCCTGAGAGCGTATCCCGCTAATGTCAAGGCTATAGTGGACTTGCCGATTCCGAAGAATCAAAAG
GACTTGCGTAAGTGGCTTTGCCTTGCCAATTACTTACACAAATACAGTGAACATTACGCTGATATGGCTTGGGCTTTAACTGATCTCCTTAAGAAGGACA
CATATTGGCGCTGGAAAACACCCATGCTGACGCATTTCGGGCAATAATGGAAAGTCTCCTCCATGCTCACATTTTAGCATTACCAAATCCTGAGTACCCT
TTTAGTGTTGTCTGCAATGCATCCGATTTTGCTATAGGTAGCACCCTGTTAGAAACAGATGCTGCAGGCCGCGAGCGGGTTATCGCATTTGAATCTCGTC
AGCTGAAAGCTGCTGAAAAGAACTATCTAGTTCATGACAAAGAGATACTTGCTATGAAGTATGCGTTCGTCAAATTTAGAGTCCATCTGCTTGGCTCCGA
TCCATTCGTCGTCTATACGGATCATGCGTCATTACGCACGGCGACACAGTCGCCTCATCCCTCTTGGAGAATGGCTCAGTGGCTTTCCTTCTTCGTGGAA
TATAACTTCGAGGTGAAGTATAAGCCTGGCAAACAAAATGTGTTGGCAGAATGCCCTCTCTCGCCTACCTGATTATGAGCTTGCTTATGTCACGACTTTG
TCGTCTTCTCTTGAGGATTTAATTCGCGTGGCATATCCACGGGATCCTCACTGTGTGTCATTGTTTCATGCCCTTGAAAGTGAGGAATACAAGCACTCGG
ACAGTCAATTATCCACACGCTTGCAAGCCAGCCTACATCGATATTCCATCGACAATGGCCTCTTGTGCTACAGATGTCGCGGATACCGCTCGCATTGTTG
TGCCTCACGATGAGGATTTAAAGTATCGAATCCTCTTTGAGGCTCATGGTACAGCCCTCAGTGAGCAATTGGGCCGGAAAAAGACCTATAGCTCGGTGAG
TCAACACTACTGGTAGCCCAAACTCTACCAATGGGTGAGCACATACGTACGTACATGCGAAACGTGCTAGCGGGTCAAACCCTCAGCACATTCTGGTGCG
CCACTCGCCAGTTTACCTGTGCCCATGTGGTATTGGGAGTCCATCAGTATGGGTTTTGTGTTTGATCTTCCTGAAGACAGTGACGGTAATACGGGAATTG
TGATCTTTGTTGACGGTTTAAGCAAAATGGCTCACTTAGCGGCAGTTCCAGATTCGATCGATGGCACAGGTACAGCTATGGTGTTTATCGATCGTGTGTG
TCGTCAGCACGGGTTGCCACTGGAAATCGTCTCTGATTGCAACCCTCGCTTCACCGGAGAATTTTGGAGTTTCATCTTCAAGGTGCTTGGCAAGCGATTC
AACATGTCCACAGCGGATCATTCCGAGACCGATGGTCAGACTGAGCTAGTTAATCGCTTCATTGGCGACGTCCTTCGCAGTGTTAGTGCTGAGTTGCCTA
AGACTTGGAGCTCGATGCTTCCTGTCATTGAGTTTGCGTTGAACAACGATGTCCATGCCTCGACCTGATTTACTCCCTTCTATGTGAACGGCCTCAAGCA
CACCCGCGTTCCGCTAACGTTACCACTACGTAATTCTGGGATTAGTGGGGGAGAGCCTGCTGACAAGCTTGCGAAAATCAGCCCTGCTCCGATGAAGAAA
CAAGTGATCGAATTTCTCGCGACACGATTTAGTGTCTTACGACGCGTGATGCAATACCTGATAGCCAGGACGAACAAAAAGAACAAGCTGATGCTAAGGG
CAGACGATGTATTGATTCTGATGAAGTCGGAGACCAAGTCTTATTAAATGCTAAAAAATTACCTACAAATGTAGTGTCTGCCGTCTTCAAGACGAAATTG
CGTCCGCGCTTCATTGGGTCGTTTACGGTCATAGCGAAGAAAGGCCTTGCCTATACACTCAATCTCGCGCGCAAGTTGCGCACACACCCAGTATTTTACG
TTGGCTTGCTTAAGC