Description :
From Genome Similarity Track
Location :
Scaffold_1760:244- 3670
Sequence
3426 bases(100 bases per row)
GTACCCGCTGAAGTGACTGCGGAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAAAACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACC
CGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGATCATCGGCAGACGGACGGGCAGACCGA
GCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTCGCCATCAACAAC
TCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTG
GGGGAGGATCTACGACTGCACAGCAGTCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAACAAGAAGAAGAAGCACGCGTCTGT
GCAGGGCACAGACGTCGACAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTGCACCGCGAAGACGAACGCAGAGGCAGGGCCTACTGCTAGAAACGAGCT
GAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCACAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAG
CTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAACATGCAGTTTCCG
ACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTCGTTGGAGAGGTTCTGCCCCCCAGATACATGGG
AGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCA
CCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCTCAGGTACACGAATCGTCGTGTACC
CGTTTAGGTCGCGGTCGCTCAAGCGCACCGCACCCGGAAGACACAACGTGCACTGATGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGA
TCTGTGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGTGCATGCTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAG
TTCTCAACGAAAGCATTCCAACTTTGACAAAGTGCCTGCCAGTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTACCGGAGCTCGTGAA
AGAGTCCGATACAGTAATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCAACAGCATCGTCGTGGATACCGCTGCATACGTACAGCGG
GATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGGGAACTT
GAAGATGCCACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGTCGT
CTCCTTCACGAGGGCGTCTCGACCCGCACGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTAGAAGAGGCCTCGCCCTCTTCCATCTCC
ACGTCGTCGTCCTCGAAGTCAACGGCGTCGTTGACTACAGAAGAACCTTCGAGGACAATCTCTGGTTGAGTTGTCCCCGCCGCAGTCTTGGCAGCAAGAG
CGTCACGCTTTGCTTTGTGACGCTCGCGGTACTCGGGGATAGAGAGAGTCTCTATCCCGGCGGAGGACTTCTCCTCTGCTGCAGCGTCGGTCTTCTTCTG
AGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCTGATTGACGTGCCGTGACTCGGCGCGTC
TAACCTTGAGGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCATTTGTGACTCTAACAGACACGACGTCTGTTAGAAGTTCGAAAGAC
TTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAG
CATCTCTTAGCCAATGAGCGACATGCATAGCAATGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAA
ACATAAAACAAAAATAGCAGTTCTCATCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTAAC
TCAAGTAAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTTTAAGCCGTAGTAGTGAGCCAAGGTAAGCCCACTACAATGGTGGACTTGAACCCG
CGCGGAGTGAGTGGCAGCGGCTGCAGGGCGCTCTGACGGGGCGCGTAGGCGTGGCAGGGAGGCGGAAAGGCTGCTGGGGCGTGCGATGGCGGCTGAAGCG
GTGCAAAAGAGCAAGAAGTTGGCCAATGTGGGATTCGAACCCACGCCCTTTCGGACCACTGCCTTAAACTGGCGCCTTAGACCGCTCGGCCAATTGACCA
CCATACGCAAACCACAACCCTCACGC