Description :
From Genome Similarity Track
Location :
Scaffold_3774:244- 1393
Transcript NameFunction/comments
Phyta_totarag15473reverse transcriptase

Sequence
1149 bases(100 bases per row)
CTGGCGAATAGCCTTACAAGACGTATGGTGTATCCGATGCCCCTGATCAACGACCTCCTAGAAGATCTGGACAAGATCTTGTGGTACTGTTCGCTTGACA
TGGTGAGTGGGTTCTGGGTAGGTACGATGACAGATCGCGCCCGAGCAAAAATTTCGGCCATCACCACGTCGTTTGGCTTATTCGAATGGAATCGGATGTC
TTTCGGCCTCAAGAACGCGCCTCAGATCTACCAGCGCTTACTGGACAATGCGCTGTATGGGTTCACTCGGATCGCGCGATCTGGTGACTGCCAAGGAATC
ACGGATCTGTTCGAAGACAGAGAGGCGGACGATCCGAGTTAGCCGTCGGTATTGGGACGCAGATTCTACATCGATGACATCCTAGTAACTGCCAGATCAT
GGGATCAGATATGCGACCGAGTGGACGCCCTGATGACGGCTTGTGATAAGTGGAATTTGTCGATCAGCGTGATCAAGCGTTTCTGGGGAAGGCACAAGGT
AGATTATTTGGGACATCAGGTGTCGAGTGACGGGCTTGAAGCCAACCCCAAGGACTTGGAGACGTTGGCAGGTCTACCCTTCCCGGGAACATTCCGAGCC
ATGCAGTCTTTCCTGGGTAGTTTGAATTACTACAACCGCTTCGTCGAAGACTACGCAATTTATGCGGCGGTGTTGTATGAATGACGGGAGGTGGACTTTG
CCgcgctgacgaagaaggggAAGCATGAGCAGATCGAGAGCCGGCTACAACACCCTGATCCGGATCTGGACATACCAGATCCAAAGACTAAATATCTGGA
GGCGAATGGGTTCGGCCCTCGAGATCGAGAGGTGTCGGCAGTAGACAAAATCGATCAACGATGGATCCAGGCTTACCGAGCTTTTGAGGTCTTAAAAGAA
AAAGTCGCGAAGACCCCGATCTTACGGCACTTTGACCCAGAACGTCAAGCGGTGGTGGTCATATACGCCAGTGACTGGGCGATCTCGGCTGCTCTGATGT
AGGATCACGATGGGACGCATTATCCTGTCACCTTTGCAAGTCGAACCTTGAAATCGAATGAGCTGAACTACGGAGTGGTAAAAAAAGAAGTACTGTCCCT
GTTGCGGATCTTAGATCTGAACTATAATGTGCTGGTGGGACGACCAATC