Description :
From Genome Similarity Track
Location :
Scaffold_12:243994- 250629
Sequence
6635 bases(100 bases per row)
GCCCAGCGTGCGCGTGGGGGTTCGGTGGTGGCACCCGTCAGCCAGGGAGCCGCTATCAAATTAAGAAATTATTGGCCTTCCGAGTAAAGCTCTGGGGCTG
GCCCGCCGGCCTCAGCGTGGCCTGAGAGTTTCTTGTCGACCCCCGGTCGAGCGAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAGCAGCG
TGACATCCGCTGCTTCAGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGCCCCACGGAGAGACACCGCAGGCGGACTCTTCCCAAGCCCGTCCTCACG
GGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGAGGAACACCGGGAACCAGTAGGGGCGGGGCGCCCTACGGGGGAAGAACTAAGTCTTCGTGAAGGGTG
CGCGGGTGGCACGTACCACGGGGACTTAGCCCCTGATACCTTCACACTCTCGAATCGGCGAAGAGAAGCGGTGGTCTGCTCGTAGTACACGGATGTGTAC
GGGGATACGATCATCCCTTTAGAACCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAATAGCAACAAGCTGTCCGA
TGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCTGACGGGAAGGTCGTCGCTGTTCCCAACGTCCAAGTGGATCTGGTCGTCAAG
TTTGAAGGCTTTGATAGCCTCGAACAGCTCACTGTTCTCGATATGGATTCATATGATATGATCCTGGGCATGCCCGGGCTTGAGGAGTACGAGCCCTGGA
TCGACTGGCGAGGCAAAGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTGCCCATCTCTGTCAGGACCCGGGGCGCCCG
CAAGGGTTGCCAGAGTACCAAAGCATCTGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTAATGGTGGCAGCGCCCATAAGA
GGCGCTAGACAAGTGGGTAACCTAGGTCCACAAGCGGGTAGCTTAGCTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGTGTGTTCAGAGTGG
GTAACCGAGCTCCACACACGGTCGCCCAGACCTTAACTGAAGAGAAAGACGTCGGATACGCTTCCTGTGTGGGTAACAGAGTGCCACACGCGGTCGCCCA
GACCTTAACTGAAGAGGAAGGCGTCGGACACGCTTCCTGTGTGGGTAACAGAGTGCCACACGCGGTCGCCTAGACCTTAACTGAAGAGGAAGGCGTCGAA
CACGCTTCCTGTGTGGGTACCACCGTACCACACGAGGCCACAAGTGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGCAGCGAGGCTTCACGGT
CGCCGTCGACGACGCCACCGCCACCTCAGGTCGGATCCGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGA
CAAGGCCGGTGGGAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGA
GATACCGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAACCTCAAGGCTGGAAAGGTTGCCGAGATGGTGCTCATGAGACCTGAGACCACTCGA
GAGGAGCTGAACGCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAAACCTGAATAAGCAGCGTCAGACGCGCTTGGGCTCTGAGATCCTTAAGAACCCCA
AGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACATTCACCGACCCAACACCCACCAGATCGATCGAGGCGTACGGCATGAGA
TTGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAA
GGCAGGCGTGGTGCGGGAGTCAAAGTCCCCGCACTCGACGCCACCTTTCTGCGTTCGGAAGCCGAACGGGAAGTGGCGTCTAGTTCTCGCTTATAACAAG
CTGAACAACGCAGCGGTGCCGGCCCAAACACCAATTCCACGGAAGGATGTGTTGTTAAACAACATGGCCGGGAGCGATCTGTACAGTGCGCTGGATTTCG
TAGACGGATACTACCAGATCCTGATGCAAGAGAGCGACATCACGCTCACCGCGGTGAGCACTTCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCACA
GGGCTTGTCTAACGCCCCGGCGACATTCAATCGCCTACTGACGCAACTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTC
CATAGCCGTGCCGAGGGAGGCAAGACGGTCATGAAGGTGCATCTAGGACACCTCCGGCGAGTGTTGGACGTGATGCGAGCAAACAAGCTCTACACCAACA
TCGACAAGTGCGTCTTCGCGTCACCAGAGATTCAAGCTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGAGCTGACCCAGAAAAGGTCCAGGCTATTGC
AGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGCGGTTGGGCTTGACCAACTACCTTCACAAGTACAGGGCAGGGTACGAGGGCCTAGCTAAG
CTCTTGTCGGGCCTCCTTAAAAAGGATGCCGACTGGCACTGGGGGCAAGAGCACCATGATGCCTTTGACATCATCAAGGCCAGTCTCCAAGAGGCCCCTT
TCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCTGATTACGGCATCGGGTGTGCATTTCTGCAGGCCGACAAGGCTGGACA
CGAAAGAGTCATCTCGTTCCAGTCCAGGCAGTTCAAAGCCGCCGAACGGAGCTACCCTGTCCACGGCAAGGAGCTCCTGACAATGGAGTATGCCCCTTGT
GAAGTTTCGGGGTCATCTTCTGGGCTCACGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGG
ATGACGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCAAACGCCCTCTCTCGGCGTCCTG
ACTAGGGGTTGGCCTACATCACACGGGTAACAGCGGATCTATTTGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTT
CCTCACGGCAGGAACGAGCGCAAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGG
GTGGAGCCCAATGAACCTCACGGGTGGTCGTACCCAACGTCGATGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTT
GGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTAAATCGCCCGATACGTTAAGACATGTGAAACATGTCAG
CGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTTCCCGTACCGGCTGACTGATGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCCTC
CCGCTGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTAGATCTTGCTCCGGTTCCCGTCACTGTAACGGGCGAACA
AACCGCAAGGTTGTTCGTCGATGGCGAGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAA
ATGCTGTTTCCTGTACTGGGAACTCGTCTGAAGATGTCCACTGCGGACCCCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACAC
TCTGCGCAGTGTGTGCGCGACAGCCCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGATTTTGCGCTCAACAACGGGGTGCACGCGTCCACGGGGTTC
ACGCCATTCTACTTGAACAGCTTCCGTCACCCCAGCGTGCATCTCACTCTTCGAGGAGTCACTGACTCCTCTTTTCTAAGTGAGGGAGAGGCTCGGAAAG
CCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGAAATCCTTTATGGATACCAAGCTGAACGTTGTCAGCAGGGTCCGCGA
TGCCATGACAGCGGCCCAGGATAAACAAAAGGAGTACTCCGACAAACATAAAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTATTATTAGAC
ACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCATACATAGTGCGT
CGTACACCATCGACCTGCTAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTCGATCCGCAGGGTTGCTGACTCGCAGA
ACCACCTTGGCTCAGCTCCTCAAAGCGAGGGCGGGTCACAGACGTCGTCGTGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCAGGACGGCAAAACTGCGG
TCAAGACCGTACGCAGGAGGGGCTCCAAACGGACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGG
AGTGCGTCGAAGGCGGCTCCGGACGTGGCAACAGAGCCTCGATCCGTCGGATCATGCAGAAGGCCTCGTCCAGATCGGTCGAAGAGGCCCGGCGATCCAC
CCGCAGATGCAGGCTCGCGACCTCACGCTCCAGCAGGTCCAGGCGGTCCGCAAGACGAGCGATCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCG
CCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAGCCTCAGGGCCCTGTGTCGGACCCGCAGCTGAAGCACTCGGAC
GAGAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTTTGAGGGCACCTCCGCCCCTGCCTGACCGCAATAGAGAAATCCACTTCCACGTGGAGCGGA
TCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCTACTCCGAGAACTCGTGGAAGCCGATTGAACGGCTCCT
GATTGACTGCCCGAAGACTGTCGCAATCTGGGAACAGAAGCGACGGCAGCTTCATAAGTAGCCCGGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAAG
ACACTCCGTACCCGCGCTCATCATGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGACCAAGTGGGCAAAGCGAACACG
AAGTTCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCATGCCCAGAAC
ATGTCCTCACAAGAACCCCAGGTGGGGCAGTTCTCGAGCAGAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGTTGTCGGGCTTCTAACGAC
AAGTCGTAAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCCTTCTGAACAAGAGC
ACGCTCGTAAATGCCCCTAGAAGTGTGTCGGCCCACAAGACCACGAGAAGCGACGAGAAGCTCAAGGAAGAGGTCAGCCCCCGAGCTCTCGTCGGGAGGA
CAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCGCACTCTGGGCAGCTTGGAAGTCCTCCTGCTGCTGGG
CGAGGTAATTCGTGATCTCCCGGAGCTCAAGAATAGAACCCTCTTTCTCTTCCTCCTCCTTCTCGTCCTCTTCATCCTAGGAATCGAAGAGGCCCCGATG
GGAGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAAGCCGTACGCTTCTTAGAGGGATTGGCGCCTTCGGCTTTAGAGACCTTAGCACGCACA
AGACCCTCGGCAAGCGAGAGATGTTTGCGAGGTTTCCCCTCCTCGTCGTTGCCAGCTTTGGGGGTGCCTTTAGCCTTGACGGCCGGGCTCTCAGAGCACA
CAAACGTCCTAGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCGGCCTTGTGCTCACTGGGCACTGTGCACTGGGCTGTGCCCTCCCG
CAGAGCCCGCAGGACATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGTCAGAGTCGAGATCACGTTCTACGAACCGAGGGTTCGGACGATTGTCT
GGAGAGGCCGAGGGCGACGGGCTGTGGCGCTTGTTGCTCGCTTGCCCACAGCCTTGCCGCCCGATGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTC
CTTAAGTGCCGAGCCTTTGCCGTGAGGCTTAGTTG