Description :
From Genome Similarity Track
Location :
Scaffold_77:24399- 34195
Transcript NameFunction/comments
Phyke_g3243hypothetical protein
Phyke_g3244hypothetical protein PHYSODRAFT_558912

Sequence
9796 bases(100 bases per row)
CGAGTCAAATTGCTGCGATTGATAAAGAACTGGAGGCAGTAGCAGAGTGCAAGACAGCCGTTAAAGCCGACATCAAACGGCAGAAAGCGAATTAGCCAGC
AGTGTTAACGAGCATTACAACATGCTAGGTCTCCTGCATTCAACACATGCAATTTGATCGGTCAGGAGTTTCGTCTCGGGTTTATTTCCGTTGAGATCGC
CACCTGAAAGCCGACGGAAGACTCTTGAATTCACCCTAGCAGGGCGCAGACGGAGTCATGGCGACTGCCAAGAGAGAAGCGCTGGTCAAGAATTTCCTCG
ACCAAAGGCATCCGAAAAAACAGAACTCGCGCAAGCCGCATCATCCGCTGCGAGGGCATCGACATCTCGTTACTCTTTCGGAAGAGGAAATAGCCCGGCG
AGAGCAAGGGTGGAATGATCGCTTTTCAGTGGATCCACCACTCAAGTCGAACAAGGCATCGTCGCCATTACATTCACCGACAAATAGTACCCCTCCTACC
CCGCTGACAACAGAGTCCAAGATACGAAATGAACGCGCGCAATATGGTATGATGCAGATTTTATTTGGTCTAGTTTGAGGGGTATCAAGGATTGCCCGTC
CTGAATATGCGCAATGTTCTAGGCAAACGTGGCAGGAATCGTAACAGTCATGAACCGAAAAAGCCATCGAGTGGGAGACTGATGCCTCTGGGTACTCTGT
CGAAGCCGCCTACGGTAAGCTTTAGCCTGCATGTCATTTACGGTCCAAACTGGTGCAGTGAAACTGAATGTTATTGTTTCTATAGGAATCTACGCAGTCG
TCGAAGGAAGAGAAACTTCGTTTTAAAGTATTAAAAGCGATTGATGCCCGCGAGACACAGCTATATCAGCTCAGCGCCCTGATTCTCTGCACACCAGTCC
AGGAGTCGCTTTTTCTCCCGTCACGCCCAGCCGAACCACCGACAACGAACCATACCGGTCGGCAACAGATGCGCTCGAGAGGAGGAATGGCACTTGCGGC
GACCCCATTGAGCCGCCATGGAGGAACAATGACAAATGCGCGTGAAGCGACTAAACtagcgcagcagctggccACAGATCTTCAAATTACAGGAATTCAG
TGTGTGGAGGCATTAGTTGAATGGATGCTGGAGGCTGGAGCGCATGCTGAGTATGTATTACTCTCTTCTTGTTTCTGGCGATATTTTTTTTGTAGTGACT
AACCCTTTCAATTGCTCTGTTCACAGAACCCCGCCACCATTTCTGTGGCGTGGCCGAAATTACTTTTTGAAGATGGTTAACGATTTGGATTTTGCAGAAG
CGGAGTTGCAGGCACGAGGTATTAACTTGGATTGCTTTAAGCAACGAAACCCACTGCTCCTTAAGCCAAACCAAAAGCTTGGTCGTGTTTTGGCTGCGCA
TTCTATCGTTATGGAAATGGTCGAGTTCGCGAAAGATCTGACCCCGATGGAACTGCTTGCACTTAGTGGACGAATGAACGATTCTGCCCGCGAAGAGAGG
GAAGCTAATTTCGCGGATGCTCATGCTCGTACTCCTGAGAAATCCAAAGCGGGTGCCACTGGATTGGGGCCCAGGGAAGATAGTACTGGAGGAGATTTAC
AACATAACAACGTGGAGAAAGACAGTGGGGGGTATGAACGGACTGTTGGCAATCACTCCATGGACCATCATGTGACTGCAATAGATCTCGTTAACTTGTT
AGACGAAAGCCTGGACTTTATTCGCCCGCACGCTTCTCGTGAAGGTGGTGTAACACAGGCAGCGACTAGCTACGAAAACAATGCTATGGATGACAACTAC
AACCTCGCTATCAAATATGATAGACAGATACATGGCCTGTTGACTGAAAAGAAGGCAGTTGAAAATGATGATAATAGGTCGACAGAAGAACCAGAAGAGG
GAGACAAGGTTGCTGGTAGTGTATCGGCAGCTGATATTGATACGGATGAAACTAAAACGCCAGTGAACAATCAGTCTGAAGGGGAGAATAACGGAGAGGA
GCATAGCGAAGGTCACGAGAACCTCGACAAAACTACGATCCCGTCACTGTCAAGATTATCGACACCACTGTCTGCAGATATTGCAAAAGACAGCGAACCA
GAGCATATAAATAATTATCCTGTCAATAAGGTTATGTCGGAGGAAGCTAACCCAAACGATGCAACCGATGATTGTGATACCACTTCCGAGCATGATCCGC
ACTCGTCGCGAACAAatgacaacagcaaccagtCCGAGTACGACAACGaccgtggtggtgaagaagccGACCAGCACAAACTTGACACTGAGGTGCAGCC
ACAACTGGAAGATATGGTAAAGCTACCGATTAAAGGTGAATTtaatgagctgcttgctccAGAAGATAATGATTGTGCAACCAAAGATGAAAGCACACCT
GTCGAGCCTCCCTCTTTTGAACAACATTTGAGCAGTCGAACAGAAGAAAGCAATCCCGAGTACGATGACAACAGCttcgatgacgatgagattgctgctg
acacCGAAGAGAGAAAAGGAAACATCGATCTCGACAACGGTGATCTCGAAGTATCTTCCGACATAACAACAGCAAGTGATGTAGCTAATATTCCGCCTGT
TCTAGACGTACAGTTGGAGCGGCTGGCCTACAACGACAGCAGTTTACATATTCCAGAGGCAGATGACCCACAGTCTATCTCGAGAATGATGGTTGACGAA
CTCAAGCGGTGGTCTTTTCTCACGGACGCGAATGGACCCACCGAGGTTAACATTCAAGAATGTCTTGCGTGGTGCAGCGCTCGAGCATTGACAGAAACTC
TACAGAATCACTTATCGATCCGCAACTGCATGGATGGGTCCTTCATCTCAATGCTAAAGCAGTATGAACTCGCAGTACCTGAATTACCTCTACAGAGTTT
TCTGTGCAGCGAATTGGCAAAGAAGCTTAACCTCATGGCACACCTCATTGATGAATGCCAGTCTGTACTGAGCGATATCTGCTCTGTCGTCGTAGAAGAC
ATGCATCGTTCCCTTCAAGCAAAGGATTCACTCGTTTCCGAAATCAATATCAGTGAAGTCCTGGAGGTCGCTGAAGGCGTGCGCCAGGAGTACCATGCCT
CAACATGGGAGTACCTCAAGGTTGCGACGACACTGCTAGCCTTCTTTCGTACTACTGGAAGTGAACAAGACCAGACCAAAACATATATATCTGCGGGTCT
TACCCATCTTGTGAAGGTGTTCTATCCGTACTTGATTAATCAGCCACGCGAAAGGCTCAGTGACAATTGGCATCCTGTGAAAAGTGAGTTCGCCGCTATG
GGGATGAACATCGACCAGCTCTACTTTATATTGGATCCGATGTGTAAAACCCTGCTCCTAGCTGTGAATTTACGCGGCTGGTCGAAGCAaaacgctgaag
aagacgatgctCTTGACGTCCCTATCTTTCCCAAAGTCACTGTCATCTGCGACCGTGACGACGTCTTGCGATCAACCGTGGACTACGTTTCGCACTATCA
CCTGTCGGTTAAGGAAGCACTCTCGAACTTTGCCCTCTCCCCGTTCTTCAAGAGCTCTTTCGGCGAGAAAATTGTGGACGGAGTAAAAgtcgaagaagga
gaagggAAGGGGCCGCTGAAGGAATGGTTTGACTTGGTGGGTATGCAGTTGGCGTCGAAGTGGAAAAAAGTACCAATCACTTCAATTCTTTCTGATCCTG
ACTTGAACGAGGTCACTGCAAGTGGGAACGCGATCAccattcctgctgctggggaTGTCATTTGTGCTGGATTCCAACTCGAATGGGAAGCTAGCGATGG
AGTGGCGATCCATCGAGTTGTTAACAAGAGCGTAGGAGATGGCACTTTCCTCTTAGACCGGAGTGTGCCATCCCATTCGTTTCCTGCATCACAGCTGCGC
GTCTCACAGCCAACAACGGCCTTCTTCGAGTACGTGCAAGGGTCAGAGACCTTTTGGCTTAACGAGAATACTTGTGACTCCCCTAAGAACCGCAAAACGC
TGTTTTTTGTCGGGTGGTTCCTTGCCTGCGCTGTTACGCACTTTTGCTCGTTTCAGCTGAGGATTCACCCTCTATTTTTCCGCATGCTGTTGGACCCGTC
GCACTGTGTGACTCTGGAAGAGCTGAGGCTATTTAATCCACCGCTGTTTAAGTCCTTGAATGGGATGAAGGAAATGAAGCCGTCAGATTTCGCGGAGTAT
CTGAAGTTCGAAGGTGCCGACGAGGGGCTTAGCGTCGAGGAATATATCGACAGCACTCTTGCGGAAAAATTTGGCCCGGAGTCTGGAATTGGATGGCAAC
TTGACGCTGTACGACAGGGTTTTTCTAGAGTCATTTCCATTGAGCAGCTCGGTCGTGTTGGCATGAACGATGAAGATCTAGGGAATATTATTTatggtgg
cagcagcgatcGTGGCAGTGAGGATTTCACCATCAGCGATGTTTTTCGTGTCGCCGCGGACTCTGACTTTACGAGCTGTCGGCCCTTGGCGGACACATTT
TGGCAGACGGTGAACAACTTTGAGCCACAAATGAAGCGCAAGTTTATTAAGTTTGTGACGGGTGTCGATACGTTGCCTTTGATGGGCACTGAGGTAAGTG
TTAGCGCCACTTGCTAAAAGTCATTTCGTGAATGACTCACACTTTTGCTTGGTTATGTGATCTCGACTACCAGTTCTTGCGAATAGAGATGCCTTTCACT
GCTATATCAGCAGATGACCACGAGAAGAGCCTCCGAATGCTCCCACAGGCCCACGTAAGTATTTTGTCATATCACTTCTGTTTCATAAAGCATTGGGCGG
CTCTGAAATCTCACGTGGTTCGCTCCGTAGACTTGCGACAACACGCTCGAACTTCCTCATTACTGGAAGGCTTTATGCTGGAGAGAGCAGCGCGGTGAGC
ATGAGGCGGATAGCAATCTTGTAGCAGAGCTGGGGGTTTTGTTGCACAAGAAGCTACAGGACGCAGTGGAATATTCCAGCGGGTACGGGCTTGACGGCAC
TGCAGAGGTTGAAGGTGTGTTCGTAAAAAAATCTggaggtgacgatgatgaccaGTTGGTCAATGCCAGCTACGATTCGTTGGGGCTTCCTGCATTGTCG
GAACGACCGAGTACCGCAGATCCGGTTGCAGACAACTCACAGCCCTCGCCACCGGCGTCAGCAACTAATCAAGAAAACGAAGCTCTTGTAGAAGGCAGCG
CAAAGAATAGCTCTGAAAAGCCAGCCGCTGTTGTATCACCACGCCAGGAAGAGTCTTACGATGACTACGACTgggaggaggaagaagaagagcaatGAGT
ACTATACTTTCAAGTTTTAGTGAGCGAAGGCAGACCGATCCAGTAGGGTAAACTAAGGTTAGAATTAGCAGAACAGAAGCACTTTGTGGCGTCGATTGAG
TCTATCATTCTTCGTTGGAAGAACGTGTAGGAGGTAACGCGTCAAAATAGCTCGGTGAAGGGGGTTGAAACGATACCCACGccgtcttctccttgataCC
TCAGCGTAAGTGACAGTCTTCTCCACCCCCGTATGGTGCGGCGTCGTCGCAATGCGAACTGCAAGTAGCATCATCGATCCAGCAATGTTCGGTCTCCGTT
CTCGCACCAAGCATCTTGAGCGCAACATAAGGTAGTTATAGCAGAATAACATCATCTCAAGCATCTCAAGATGGTACAGTACCTTTCGATGACGCCATGA
TAACACGCAGGATTTGCCCATGTAAATGGCCGAGGCGTTGCCACGATGGGATCCCATCCAGTaacctgcaaaatattttagCCAAAAGTCCATGGCCTAA
ACGTCTTGACCTTTTGGACTAATCCAAGGGGCAAAACCACGTTTCGGCCATAGCTGGCCGAAACTATAAAGTCCCTTCTGCCAACAGTAACGGAAGTCCC
TTACCTTACTAGTGATAAGCCCCTTGGGCGCAGATTCCACTTGTACGATAAATCGCCCACAGGTGATTCATTCCGTGCGCCGTTTTCCGACGATGACAAT
CTTTGCCATTGAAAGGCATCCCTATTGCCAAATCATGATACTACCGCAAGTCAATTGCTAGATACAGGTTGGATTGGACAGAAATTGGGATTCTGGTGAT
TCAGAATGCAGCGAGTGCGTGACGGTGAAGCAATCTCTTGGTCCCTCCCTTTTACTCTGTAGGGAAATGCAGTCCGCCACTCGGCATGACGCGACCAAAT
GTGTTAATAAAGGACTTTGCGCTCGGGCAAAGAAAACAGGACCTCCTTAACCGAAAGTTGCATGGAGATACATCGAATGTGCACGCATGCTCCAGCAAAA
CCTCATGCACCTTTGAAGCTCGTGTGCTTCGGTCGAAGAGTGCTGTGTCGAGCGATTTTGTCGTTGGTTTCTTTAATGCAGAGCAACAAGTTGCCGGCGA
AGCAGTGAGTCAAGCCCAGACTGTTCCCCAGAACAATGCAAAAGCGTAAAGACCTTTAGTTACCATGATGGTGCAAGTAAATCAATAAAGGCTATTGACG
CTATGAGTGTTCCTAGAGTCTAAAGTGCACGCTGTACCATTTCAAAAGTAATTTTAAGTATTTTTTAAGTCGTTGAATAGTATCAAGGTTTGTCATTCAG
TATTGGTCATTGACTTAGAGGAGTATCAAATTTTGGCATCTCTGTTCCAAGTTGCACTTAAGTTTCTACTGAAGTGGTTATTACGTTGCAGCTCTGACTA
TGCAAAAAAATTGAATTGTCCGGACGGAGAGGGACCGGTGACGACCTTCAGAGCCCTTCACTTCCCAATTCGTCGCATGCTTGTAAAGTTGCCATTGACC
CCTGTATCTTGAGTTCATGACAAACCAATTGCCGGACGGAGTTGCGCTCGTGACGCTCGCGCCACAACTGGAGCTCGAGTCGGCACTGGACCAAACACTG
GAGCTGTTACGCGTGACGCTGAAGGCTACTGAAGGAGTTACACTGCAGGACAAGCACCGCAAGAAGgcggcggaggtggcggtaTTGGCTGCTAAAGTGC
AGAGATCATgtgctggtgtggctgccaGCAAACAATTTGAGCCGCTGCAGTCCAGCCATGATGTCAGCGAAGCTTGGGCTGGGACTGGGACTgcggagca
ggaggaggctgcacaGCCCTCGGTCTGGTCGGGATTCTACAACAAGACGCTGCGTGAGAGGATTGATGTGCTAGCATTGATGTATCCGAGATTGCAGCGT
CTCAAACAGGCGCAGACGACAGCTGCGGAGGTGACAGCAGACCTTTTGCCCCCGTCGGACCCAGCCGCTAGGCTCGGTGAGCTGCCGTTGCGAACTGCCA
ATCTCATGATTGAGAACTGCATCGGCGTGCTCGGTATCCCACTTGGGTAAGTAACTATGTGATTGAATTACTCATTATTTGGCTAGTCGTGGTATAGGCC
GACGATGCCATTCGATTGACGTCCCTGATGTGCTGCATATCTGGTTATTGTAGCCTCGGTTTGAACTTTGTTATTGATGGCAAGAGTTTGTCGGTCCCGA
TGGCAGTGGAAGAGCCCTcagtggtggcggcggcgtcCAGTGCAGCGAAGCTCGTGGCTGCTGCGGGCGGAGGTTTCCACACAGCGACGTCCGGCAACAT
CATGACGTCGCAGATTCAGTTGGTGGGGACGGAGGACATTCCAGCGGCAATTGCAGCCATTAAGGATAATCGTGAGCGCCTGTTGGCGATTGCTAATAAG
ACGCTATGCCCAAACATGAAGAAGCGTGGCGGAGGTGCCATTGATATTTACTGCCGCGTGGTTAGCCAGGCCGCTCGgacagcagccactgcaaccGCTG
GGAGTGCTTGGTACACTCCTTGcgacgacgaactggtgGTAAATGCTTCCGAGTCGCAGACGCATTTCTTGGTTGTGCATATCGACGTAGATGTGTGTGA
AGCCATGGGCGccaacatcgtcaacacGGTTGCTGAAGGGCTCTCGGAAGAAGTCTCCAAGCTCACACGAAGCCGCGCGGGTCTGCGTATTCTCACAAAC
CTCTGTATGCAGCGTCGCGCGCGTTCTGTGTTTGAAATTCCGCTCCAAAAACTTGGTTGGAAAGGAGTGGATGGTGAGGACGTCGCGAGCCGCGTCATCG
AGGCGTACAACTTTGCTGCTATTGACCCGTATCGCGCGGTGACCAACAACAAGGGCATTATGAACGGTGTGGACGCGGTGGCTGTGGCCACAGGGCAGGA
CTGGCGTGCCATCGAGTCTGCTGCGCATTGCTATGCTAGTCGTTCAGGGCAGTACACGTCGCTCTCTCGTTACGAGATTGGCCTCGCCCGCGATGGATCA
GGCACGCGTGTGTTGCGCGGCAGCCTGGAGATGCCCATCGCAGTCGGATCTAAAGGCGGTGCGTTAATGACACATCCGGGTTATACGGCCACGCACGCAA
TTTTGCAGCAACCGACGGCCCGTATATTGAGTGGCATCATCGTGAGTGTTGGGTTGGCGCAGAACTTTGCGGCTGTTCGTGCTATCGCAGTGACGGGCAT
CCAAAAGGGCCACATGGCACTCCACGCACGCAACAttgcagtagctgctggtgcccCAAGCGAGCTGGTGGCAGAAGTGTGCAGCTACATGTTATTGCGG
AAGGCGATCAACGTGGAGGCGGCGAAGGAATATCTCCACGCCCACGCCGTCTTCTCTGAAATTCAGAGCAACTCACCACCGTTATCTCCAGTATCAGTGA
CGCTGCCGTCTATGTTCTTTGTGGAGATCCCCATTCCAGAACTAGAAAGCACGATCAGCCTCAACATTGCATTCGAAGCCATTAACAAGCGCCCGCAGTA
CATCGCGATCATGGCACCAGATGGACGCAACAAGGTGCAAACGACACTGCAACGGCAACTGCTGGGCGACAAAGGCTACAACCAGCTCGAAAAGATGTTC
ATGTTCTTGGCGTCTATGCGCTCAATCGTCATCTCCAACTCGAACGAGAAGGGCGGACTGCCTGTTTCGCGCTCGAACATTGGGCTACAGAACAAGCTCC
AACTACTATCCATTctcatcaacatcatcgcgTACCGCCTCATGGAGGTGCGTCCCCCAAAAGTACGCACGTTTTTGCGGAAACTTCTGGAGGTGAGCGG
CGGGTCTGCAAACGGAGCCCACGATGGTGAGTTGCATGAGCTGGACACAAAGTGTTTTCACGACCTGATGGTAGAATGCGTGGAGCCTGCGGATGAAATC
CTGTCCACAGGACTGCCACTGTTCCTCGCACTGTGGCAGGTGCTTCACTACCACCTCGAGCAGGAAGTTCCGCATAAGCTGCTTCGAACCCGATTGATGA
AAGAGCAGTGGGGGCTCGTGAACGATATCGTGAGGAGTTATGAGCTGGGCACGCTCTCCACCGATACCGCTGGCGCATTGTCTGAAAACATAAGAGCACC
CGACAAATTGCTGGAAGAACGGTTCTTGGAATATGTTGCAGTGCAGGCCACCCGCTGGCAGGCGACATTGCTGTTGCTTATCGACTCGCTGGCATTGGCA
CCAGAGCTGATAACAACCGAGCGGTTAGATTTCCTTACGCGCATCGGCGAGTACATGGAGTGGGAAGGCTCCATCGCGCACGACCTGGCGCGCTACCAGC
GCGATGCCACTGAGCGCGTGCCCAACGCGTATCTCTTTTGGCTTTTCCAGCGCGGTATCCCTCATTCAGAAGGCAAGGCGTACGAGAGGGAATTCCGTGG
CGTGGCTGACACGTTGGCTGAACAGAAATGggagcagcttctcctggagGCGCGCCGTGACTCGTGGGCCGCTGCCACTTTctcacttccagcagt