Description :
From Genome Similarity Track
Location :
scaffold_56:24385- 25765
Transcript NameFunction/comments
Plaha_PHALS_042942og-fe oxygenase

Sequence
1380 bases(100 bases per row)
CTTTGCCACACTCTGAAGCGATCGGCGTCGCTCTTTCACATCAACTACCTCTTCGTGTAGACTCATCATACTCTGTCTCAATGTTTCCAACTCGCTTGAA
TACTTTTCGATGCTCTGGATATCCACTNNNNNNNNNNTATGAAACGACTCCAGCAGTGATATTGAAAGTGTTAATAGTAATGTCTGGGGATTCTTCCCCG
TCCGCTTTTCCTACCCCTGATAAGGCATCGAGAGTACCCCCAAACACCtcagagacagcgatgacGTACGAGTACATCGTattgtactatatagtactat
atagtactatataCTATAGTATAGCGATGATGTatgatgtactatatagGGTACGCTCAACTTGTTGCGGCATTTAAAAACATCGTGGGACAAAACGACA
AAGAAACATGAGCGGCGCTTTCTTTGGGGACTGAGAATCATACTTTGCCCCGTCAGCTGCTTCATCTGCGCGGAACATGGCGGTCAAGCGGANNNNNNNN
NNgcaaagtgaatatattaaggtccttagttcgcagtgctacctctaagcctatctagaNNNNNNNNNNTAACACCGACAATCAAGTCCAGATCAACACC
AACAATCAAGTCCAGGTCAATCAACAGGCACCTGATTTAAAATACAAGTCTTTGATTTACTCCACAGCTCAAGCTCCATGCCCCAAAAGTTTGCGAGGAC
ACGCAGAAGATGCAATTAAACAAATAGAGGGATACGTGCCACCTCCGCCGGTTCAGCAATTGGTTGATGAGGCCAAGGCTTCTCCCAATATCGCAGCCAC
TGACTGTAATCCACACTTCTGACAAAGTCATGTGGAAAGAAGCGTTTTGTTGTACTAGTCAAAAATCCTGATTCGAGTCTTCTGTGCTTAGTGTGCATCA
AAAACAGCGAAATAGAGTAGCTGATCACCATCGATTACTCCTAGCTACCGGATTTTGTAAAAAAGAAAGATAATACATCAGCACTATCTGCGTTGTATGT
CATTAACTACGCATTTCAAACATATTGTGATTGTCTACATCAGCGCTGCACTCCTGCCCATTTATCCATAATGTACTCACCAAAGCACCCGTCACGCTTA
CGTACTGTGCCATCCAGCAAATTATTAAAATACTTGCTGTCTTCACTAGCATTTCTTGCATCGCCTCCAATACGTAGTTTTGTTACATCAGTAATTGACG
GTATCACTGCATCAAAGTCGGGATAGTAGAAAAACACAAGCGAATAACGTTCTTGATTATCAGCCACAACACGATGGACAGGCGATAGACATTTGCCATC
TGTAATAAGCGACAAATAGTCTCCAgcattgactacgagtgttcCAGGTATATAAGGCACATCCACCCATTTGTCGTCAT