Description :
From Genome Similarity Track
Location :
contig_60:243804- 253372
Transcript NameFunction/comments
g11195.t1hypothetical protein
g11196.t1hypothetical protein

Sequence
9568 bases(100 bases per row)
ACCCAGTCCAACGCTCCATTCGTTTCTCGGAGCACTTGTATAATTATCTGATCCCCTGCAATTGCAACCGTTGGTAGCGAAACTTCCGACACTGGCGCAC
ACCAATTATTGCATTCACGGCACACTACCAAGCGCGACCCACATCTGATGATATGGTGAACAAACGCAGCAAGAACAGGCGACGGGCCTCCTTGTCGACC
CACAACATCCAGCGTGCTGCAAACCCTGAACGCCGCCGCAGTGAAGCTACAACCTCTACGAAAACGAGCGAAGTTAGCTCTGCCGAACCTGTAGCCGAGA
ACGCCCAGCTTTTGCCAAATCCGCTGAGGTTGACTAATGATGGAGATATTACAGCAATGGAAGAAGGACAGCTCAAGAATGACAAGAAGATAAGTATTCT
CTTGTCGCCAAGGCTGGATGCTCAACTTGGTGGATACCCACCCGATTGTGGCACCAAGGAGCTGAAATACCTCTCGTACGCCAAACTGGTGCATGATCGT
GGAACGACTCACCCGATGCGTTACTCAACGACCCACGTGGACGCACTGGGTTTCGCCATGCCAGAGCGATATCCGTTGTTTTCCACCGACTTTGGCGCTC
ACTCTTTTCACCACCTGCCGACTGACTCGGTTGTTCTAAGCCAGTATGGCCTCGGGGTCGCGCTTTACTTTAAGTATCTTAAGGTCATCACGTGGCTTTT
TCTTCTGCTTGCCGTGATCAGTGCTCCTGCCTTAGCAGTCTACATCGTTGGCGGCGGCACTTCTATCGCGGAACTTACTGCTCTCGCACGCCAAGACCTT
CCGTCCGTCTTGGGAATTACCAGCATTGGCCATCTCAGCGAGGCCACCAGTGTGTGTGATCAAGCTTTGGAGAATGCCGAGCTGTCACTCACGTGCTCAG
CGGGTGAGATCGGATTTGTCAAGGCAGTGTATTCGACCTATGACACCCAAGGGTCCTGCACATGCCCCGAGCGCAACAAAGTTGCTGAGGGTTCTGGGAA
GTGCCGAGGTGACGCAGAAGGATCGGTTTGCCCAGCGGACGGTCTGGGTTGTTTTCTAGGCGTGCACCCAGTCTCCCTTCGTCCTTGCTGCTCATTTTCA
CAGAATACAACGACTAAGACCCCATGGTTTGACGACATGCGCATTCAAGCGAATGAAGGTTGCGGCTCTCGCATGGCCCAGCAGATAGTCGAGGGAATGT
GTCTGGGCAAGAAGAGCTGCACGCTTAATGTCAGTGAGGCGATCACTTACGCGTGGGAACCTGATGCCAACTACAGAACCAATTGCTCCAAAACTTCAAC
GATTATCACCATTGATAGCGTCGCTAACATCACCAAGGAGGTGTGTGAAGTGCGTCTGAATGACGATAGCGACTACTCGAAGTGCGATGACGCGTCTCGT
GCACTCATCGTGTACGGGAGGTGTTTCACCACTCGTGTTGACTTATCTAGTGCCTGGAGCCTGAAGATTATCGGTTGGGATTCCATGAGTGTAAGGGAGG
CAGTTTCTTCAGGAGTTTTGGGGTCTAACAAAGGTCTAACGTTGATTTGCTGTTTAGCGGCGCGAGTTCTTGGGGCTGGCGGTAGGGTGTGATATCTCCT
GTAGCCTCGCATTCTTTGGTGTTGTTGTTTGGCTACGACGGAAAGAGAAGGAAGCTGTAAACCGCATTGCCCAGAACCAAATCAAGGCTCTGGACTACAC
CGTGCAACTCGTGAATTTGCCGCACCATGACGATCTCAATCTGCTTCGACAAGAGGTGAGTCCACCATTATTCGAGGTGCTGGATGCACCAAAGCGTCGT
TCATTCTAACGCTAGTTCGGTCTGACTAGATCCGACTACATCTTGAAGCAGTCCTAAGTAACGCGCCACCATTCGCGGTGGAGCTTGATCGTGTGCGTGT
TGCGGACGTCCAATTCGGCAAAAGCGCGTCTCGCCACTTGCGTTTACTCGGTCGTCGTGGAGCTATCGTACGACACCTCGAAATTGCACAGCAGCGTCAT
GAAAAGCTAAAGCTGTTGAGTGGGCGACTGGATGAGCGCGTTTACGCCAGACGCGAGAAGCGACACTTAAAGGCTATCCACAAGCTAGAGACGAAGCTGC
ACGGCTTCAACGTCAAACTGGAGCGGTGGCATGCTCGTCAAAAACAACGAAATATCTCTCAAGCTGTCACGGCTTTCGTGACATTTGAAGAAGAGGAGGG
CGCCCACCGCTGCCTGCAAGAGTACCCGGATCTGGGATGGTTCCACCGTCTTTTTCAACCGTACTACAAGCGTCTTCATGGCAAACGACTTCGCTTTCGC
CCAGCCCCAGATCCGACCGACATCATTTGGGAAAACCTGCATCACCCGTTCTTTGAGCGTGTCTTTCGACAACTGGTACGCTTTTAAAAACCTTGGTACG
AGTATCTCATCGTCTAACGTGCGTTCTCCATATGCTGTCCGGCAGATTGTTGCGTTGATCACGCTCGCAGTGTTGTTTGTGAGCTTCTTACTGATCTTCG
CGGCAAAGGAGCAGAAGACCAAACTCGAAAGGCAGTTCGGCCGACCATCAAGCTGTCCTGTTGATGTTTTGAAAACCGACGTCATTCAAGACGAGCAAAA
CAAAGTTTCAGGGCTCATGCCGTACAAGGCGCTCGTTGAATGCTACTGCAAGAACTTCCTCACCTCTCAGTAAGTTCATCACAGTTTGCAAGCCTTCCAT
TCTCAAACTGTGTGCTCATGATCAGACTTTAACTTTGTGCTTCGCTTGTTGCTATTACTCAGCTCATTCCGCAGCATGATGTACGAAAGCTTTTACAACT
CAGAAACTGGAGAAGATGAAATGCTCTGTCGGACTTGGGCCACAACATTTGTGACGACCCAAGTGCTGTCCATTGCCTCGGTGCTGCTAGTTGTAGCTGT
GAACCTCATTTTGGCTCGCATTCTCAATGGTCTGGTCGCTATGGAGAAGCATCACACGCAATCGAGCCTTGTGGTGTCACGAGTCACCAAAGTCTTCATC
GCGCAATTCTGCAACACCGCGCTGTTGATGCTTGCCATCAATGCGAATGGCAAGTATTTTTCAGCTTCACCGACAAGCATGAGTACCACCGGAGGCTTCT
CAATTGGTGCACTACAGGTGTTGAATGGCGAGTATTCAGACTTTTCAGCGGAATGGTACAACGACGTCGGTGTGGCGCTCATGCTCACCATGATCATCAA
TTCGTTCAGCATGCACGCGTATCTCTTAGTCCAATACATCGTGCTCAAAGCTCGCCGCTTCATCGATCGAGGATACTCTTTCAACCACTCCCTCACCAAA
CAAGACACACAGCGTGATCTTGAGACACTATATCGTGGACCCAAGTTTGATCTCGCTGCACGCTATGCCCAATCGCTCACCTCGATCTTCATCATGTACA
TGGTAAGTCTGAATTGACCTCACATTGTCCCCACGCTGCAAAACTAATCTAGGGTTGCAGTTCTCGGCAGGAATGCCTCTGCTTCATTTCATCGGATTTG
GGGCTATGATCATGACGTACTGGGCCGACAAATTCAGTAAGCTGTCATGGTAGCGAAGACTTTATATCGTCCAGTGACTCACGTTTTCCAATGATCGTTG
CAGCATTTCTCCGTATCGCTCGGTCGCCACCTTTGTACGATGGTCAGGTTGCCACTGCGGCAGGATCTCTGCTTCCTTATGCAGTGCTGATGCACTGCCT
CATTGCCATGTGGATGTTTTCAAACGACCGCATATTTGAGTCGGAAAGTGACGTGTCCAAGGAGGATTCCTCGGTCAACACCACCATCAGCCCCGGTGAT
GGCATCCCATTATTTGACGCAGCTTATCGAGGTCAGTTAATCTCCCGCGTCACCCGCCCGCAGGTCGTCGTCCTTTTCGCCTTCTTCGTGGCTGGCTGCA
CTATCGTGGTAATGCGCACCGTGGTCTTTGAATATGTGCCGGCGCTAGTACGCAGCGTTTTGCCAGCACTTGCTCGATTACTGGAAAATCCCCGTGTTGC
GAAGGGCATCCCTAACTACTTCGATGGTACGTGTGCTTCTTCGAACTGTTCATGACAACCTCTGATTGACTTTTCATGCTTTTAGCCATTCCGACGCCTT
GTCTGCAAGAGAAATTGGCTGCCACGGGCGGTACGCAACAACTTCTGCGGCCGGACCTGCGCGCCAAGTACGAGCGTGCTCTGGTTAGCCGGGTCGCACA
GGAGGAAGTTCTGTCAAAAAAGCGCTCGGTGCGTTCCATGTCAGCGACTGAGCGCTTCAACCAGGTAAACTGGATCGTCGGCTGTCATTCCTATGGTAAG
TCGCTCTTTTATCGCCATCAGCAAGCAGCAACCCTGACCAGTGCTTGTTTCATTCCAGCTATCAGCGACAACAGGGAGTACGTCGCGAAACTTGCCATCG
ACTCGCACCTCTCGGAGGAAATTCCACTCGATCAGATTTTCTAGGACGCAGGAACAACTCTGCCCTAGGTGGTATGGTACACGCGCTGGGCGTTTATTAG
CGGCTTATTTCGTGAAAAAAACTCAACTTTCCCTACTCTCTTCGTCTTGTCGGCCCTTACACGCGGCATCTTGAACACATTTATGCCAGGCAGACTATTC
CAAGGCCTTGGGAGATGGAGAGGAGCCGTCTGCAGTTGACGACGATGGCGATTGCACACGCAGGCCAACGTCTGAAAGGTCAGACCTCTGTCCTGCGCGA
GTCTGAGATCGCGTATTGTTGCTTTGGTAGAAGCCCATCGCCATCTCGGTCTCGCCAGGGCAGTGCGAGAATGCAAAGCCGGTGTTGCGGCGAACGAGTC
GCGGTGAGTCCATCACCACAGCAGCGTCTTCCCCCTTAGCCAAACGATTCCACTCGCGCATCAGATGTGATGGCTCGGGGTAAAATAATACTCGCCCAGC
CTTGGCGATATAGTTCGGTAGAATGGCGATAACCACAGACAGCAAGAGGCCAAGCCAGAACCACGGCTCGCGAATAAGCTGGTCTACCACTCCATAGCCC
ACTTCCGTGTCGTAGAAATCAGCATTGGTCCATCCGAACACAGCACAGAAGAATGCCGTGAACAGGTAGTAAAACACCAGCGTGCCGACAGTTGCCAGAG
CGTTCGTCCGTGTCCAATTGCTCGTCATGAGCGCCACTTGCGCCGTCGAGGCGGTGATCAGGTACGTGTATGACGCCACACCATTTGCCCAAAGGCCTAG
GTCGCGCTTGTCAAACTGAAGCTTTGATGAGTCACTCGAAAAGTACCAGACGATGGAGCCGTTCGAAAAGAATGGCACCGCGTACACCACGTAAGCATGC
CACGCGCCCAATATGCACCAGCCAAAGAAAGTCAGCCAGTTGAACGAACGATTCTTCAGGCCGTTCACGTACAGCGTCGGGTACTGCATCAGCACTGCAG
GAGACACGTCCTGGTTGTACATGGCAATAATCACGATCGGAATCGTCGTAAACAGAGCGTTGTAAAGCGTAAAGAAGATGCTGAAGTACATCAGCAAACC
ACTGTACATCGTCTCCATCGCCAAGAAGAAGTTAGACATCGACAGCGCCACGTTCTTCATGAACGAGAACAAGATCAACTTGGAAATTCTCTTGTAGCTG
TAGTTGCCGTGCACCAAAAGAAGGCGCTTCAGGAAGTGAAACTCCGCGATAGAATAGTCACTGGAAAGAACGGCTTGGCGGCCCTCTTTACCACTGATAC
CGACACCCACATTCGCGGCTTGAATCATCGGCACATCATTTGCGCCGTCGCCGATAGCAAGCGTAATGTTGCCAGGTGAGAACATAAGCGTGGGTTCCGT
AACCAACTTCACCACTGACGCCTTCTGGGCGGGCGAGCAGCGGCAGCAAATCACAGATTTACATTGCGTGGCCACTGCCAAGAAGAGGTATTTGATGTCA
TCATCCAGCACCAGCGCCAACGTTTTGCCATCAATAACCATAGCAAACTCCAGTTCCTCGTCGACGTAGTCACCGCTGCTCATGCTGCCAGTACCACCCG
TCATCGTATCAGTTTTAGGCTCGAAATCGTGGTCGCACAAACCACGTTCGAAGCTGTTTTCGGAAATGTCACGGTTCGGCAGCGCAGGATACACTTCATC
GAAATGGACAGGGCTGTCCGTCGGTGTCGTATCATGTTCGCGTCGTGGCAAGCGTCTCCTCTTCTTTCGGGCCTCTGCTTCTTCGTCGCGTCCCACAAGT
GCCAGTTTTACAAGATCCCACAGATACAGAATCGCTCGCTTCAACGCTTCCCACAACACACTGAACGCCGACGAGGTCTCATCTGATCCCCATTTGTCTT
CAACAAGGTCGACGTACAGTTCTTCCAGCCGAGTACGAAGCGAGCCCTTGTCGCGCTGGCCCAGTACAATCACATCCATATTATCATCGATCACGTGTGA
CGACATGCCAATGCTGAGCGCTGTTTCCTTCTTGTCACCCGTGAGCACCCAGAACTTAATACCAGCCTTGCGCAAAGCACAAATAGATTCTTCCACACCG
TCCTGCAGTCGGTCTTCGATGGCTGTCGCACCGAGCAGTGTCAACTCAACCTCAATGATAGCCGAAACCTTGGCAATTTTTGCGGCACGTCCCTCCATCG
AAATTCAGCCTGTCGGTATAGGCTGCTCCACTGTTCATACTCCTCTTGGGTAAGGCGACGCATTGCAGTGGTAAGAGTTCGAAGGCCTTCCGACGCGTAC
TCCTGAAGATGACCACGCGTCACATGCGCCACACCCTGTGGCTGGGTCTTGGAAAGGAGATCGAAAATGACGTCGTCTGCACCCTTGCAGTAGAGCACAA
TACTACCATCGGGAAATCGTACAACCACTGACATTCGTTTCCGATCGCTGTTGAACTCTAGCACGTTCAAAATCTCAAACGACATCAGTCTTCCTTGAAT
GAGAGCATTGCAAATCGGACCGTCGCGTGATTCAAGAACGTAGCCGAGGTCACTCGCAGCCTGTACAAGTGCCTCCTCGTCAGGGGAAGACGCATTGTAT
TTGATAGTTGCTGTCGGCGCCGAACAGGAGTCGCCAGTGGATGTAGGCGATGCGGGAACATTGGTCTCGGGTATCACGGTGTTGCAAATGGTAAGCAGTA
GTAGGAAATCGTGGATCTCCTTCTTTGTCGAGTGGTTCGAATTGAGACGCGCCATCAAGCGGTTATCATTGAACCGAGTTCCAGGTCGCGTGGGCTTTGC
AGGGTCTACTTCGATGTCATTGTAGCGCAGACCAGCCACAGTACACTTCGCAAAGATCATTTCGTTGCAAGTGAGTGTGCCTGTCTTGTCCGAGAATATA
TACTGAATCTGGCCAAGATCTTCGTTGATGTTGCTGTTGCGAACCTGAGCTGGCGTATCTGTCTTGGTGTCGTACATCTCGAGATCGTTTTCAATGTAAC
GTGCGTGAACAAAACGCACGCCTTCCATCGTCACGTACATGGAGAGCGGGATCAAATTGTTGAACAGGATCACGTAACTCAAAAAGATGTAACCGTTTGA
GTCTTCCTCGATGTACCAGGGCGTTGTCTCGTCAGCCAGGTCAAGGTTCCAGTTGTTGTTGCCCAACGTGCAAGCAATTGAAATTCCAAACAGTAACATG
AGCACCAGAACGAACATGGTGTCCAGGGTCTTCTCCACAAAGCTTCGCTTGAGAGGCACAGCCGTGGAGTTCATCTGGACCTTCGTCTCCTTGCCCGTGT
AAATCACGAGTCCCAACGTCCATTCAGAGTTGCGGCTCTCACTGCCACGCAGAAGCAAGTTGTCCATGGTCAAACTTGATTCGTTGTCGTCGTTGTTGGC
ATCTGCAACCGCATCGTCTGCTATCTTTCCAAGTCTCAGCACGCCGTCGAAATAGAACAGGTCCTTGTTGGGCACGTCGCACTCCACCTGGAGTTTGTAC
TTCTCCAGAATCTCCTCTGCAGTCATAAAGTGCTTCGTGCAGCTGGCTACCTGGCGGATCTTCAGGTTAGTTTCGCCATCCAAGTTGGCCGTCTCAACGT
AGCATCGGCCGTCGGGTCGACTTGTCGCCAGCAAAATGCAGTCAGCCGGAACCTGATCGCCGTCCTTCAACATCAGTACATCTCCCACTTCGATATCCTG
CCAAGTGCCATCGATGTGCATCACCTCATTCACAACGTCGCGGCGAATAATGTGCGCCGGCCTGGAATTTACCATGGCGTCTCCCTTTTGGCGACGCAGG
TCTTCGCTCACGTCCTTGAGTGCAGACGTCGCGAACACGATCAGCAATGGCGTCAGACTAGCCACGGGACTCACTGGCGAAAAGTCGAAGAAACACAGCG
CCACCACGATGGTCGTATAAAAGTTGGCGAGTCGGCTGAACTGCATCTTGAGGAACACGAACAGGAAGTTGTAGTACGTGTACTTGCTCGTAACGATGAG
GTTGGAGGAGAAGACAGGAGCCTCTTCCTGGGCTTCTGCCTCCTTCCTGCGCTGCTTCTTGGTCTTCAACGCGTCGGGCAACGTCATCGACACACCCGAC
TGACTGCGTCGCAACCTGTTGTTGGGGATGCCCGGGCCCACCACAATCTTCCGTCTGGCTGACGGACCTTCATCCTCGTCCATCTCATGGGTCGACGGGT
TGATGGACAGCGTCTGATGCAGCGAGTTGGCCCGCAGCGGGGACGGCATCATCGTGGCGAGAGCTGCGCGGTCGCACTCTCGCTGGTTCTGCACGGCCTT
GACGATGCGGCGGAGTTTCCAGCCGTACATGAAACCCGTGATGTTGAGCATGGTGAGCAAGATGGAGAAGAAGCCCTGCATAAGCACGGACGTGCCGCTG
CTGACACTATTGAGCTTGCCATTGTAGCCCTTGTAGTACCAGATGACGTCCACCAACAGCGTGAGTTGCATGCCGATCTTGTAGCTGAGCAGGAACTTGG
GCACGAGGAACTTGGTGCCATGCCAGCCCAGCACGAGCGTCACGTACAGGATGAGCACGGGCACCGTGGCCTGAAAGCTCAGGCCCAAGATAATGGGGAA
AATACGCAGCGAGTTGATGACCGTCTGCGACACGATCGTGAACTTGAGGCGGCGCCGCGTCTGGTAGATTGTCATGCCCTTGAGGAAGCAGAAAACCTTC
TCGAAGAGGTTCCACACCTTGGTCTCGGCGTTGGGCTTGGAATCAGACGCCACCGAGTCCGCCATACTGTCAAATGTCAACAACAAAAAAGGCGTCAGAA
ATGATTAGTTCACGTGTCAAAATTGTCTTTTTTTCCATTTTCCCGTCGAACAAGTCGATGTGCTTGTTTTTAGGGACGAAGGGTGTTGTGGGATTAAGCA
CGGTACCTATCGGCACGATACCGCAGCGAGATGATGTTGCGCTGCTCCTCCTCGTTCGGGACGCCCGTGAACGTGTTGATGCGCCGCAAATTCTTGTGGG
CGTGTGACTGCGACGTCGGCGGCGGCTGCGCGCCGTCAGCGGAGGAAGGTGCTGTCTGGCCCATGTCCAGCGTGTACTCTGTGGAGCTGTCGGACGGCGA
GGGCACCGCGAACTCGACGCGCATCTTCAGTCCGTTGCGAAGCCGCTTGGAGCCTATTCTTGAGCCGC