Description :
From Genome Similarity Track
Location :
contig_60:243785- 253353
Transcript NameFunction/comments
g10724.t1hypothetical protein

Sequence
9568 bases(100 bases per row)
ACCCAGTCCAACGCTCCATTCGTTTCTCGGAGCACTTGTATTATTATCTGATCCCCTGCATTTGCAACCGTTGGTAGCGAAACTTCCGACACTGGCGCAC
ACCAATTATTGCATTCACGGCACACTACCAAGCGCGACCCACATCTGATGATATGGTGAACAAACGCAGCAAGAACAGGCGACGGGCCTCCTTGTCGACC
CACAACATCCAGCGTGCTGCAAACCCTGAACGCCGCCGCAGTGAAGCTACAACCTCTACGAAAACGAGCGAAGTTAGCTCTGCCGAACCTGTAGCCGAGA
ACGCCCAGCTTTTACCAAATCCGCTGAGGTTGACTAATGATGGAGATGTTACAGCAATGGAAGAAGGACAGCTCAAGAATGACAAGAAGAAAAGTATTCT
CTTGTCGCCAAGGCTGGATGCTCAACTTGGTGGATACCCACCCGATTGTGGCACCAAGGAGCTGAAATACCTCTCGTACGCCAAACTGGTGCATGATCGT
GGAACGACTCACCCGATGCGTTACTCAACGACCCACGTGGACGCACTGGGTTTCGCCATGCCAGAGCGATATCCGTTGTTTTCCACCGACTTTGGCGCTC
ACTCTTTTCACCACCTGCCGACTGACTCGGTTGTTCTAAGCCAGTATGGCCTCGGGGTCGCGCTTTACTTTAAGTATCTTAAGGTCATCACGTGGCTTTT
TCTTCTGCTTGCCGTGATCAGTGCTCCTGCCTTAGCAGTCTACATCGTTGGCGGCGGCACTTCTATCGCGGAACTTACTGCTCTCGCACGCCAAGACCTT
CCGTCCGTCTTGGGAATTACCAGCATTGGCCATCTCAGCGAGGCCACCAGTGTGTGTGATCAAGCTTTGGAGAATGCCGAGCTGTCACTCACGTGCTCAG
CGGGTGAGATCGGATTTGTCAAGGCAGTGTATTCGACCTATGACACCCAAGGGTCCTGCGCATGCCCCGAGCGCAACAAAGTTGCTGAGGGTTCTGGGAA
GTGCCGAGGTGACGCAGAAGGATCGGTTTGCCCAGCGGACGGTCTGGGTTGTTTTCTAGGCGTGCACCCAGTCTCCCTTCGTCCTTGCTGCTCATTTTCA
CAGAATACAACGACTAAGACCCCATGGTTTGACGACATGCGCATTCAAGCAAATGAAGGTTGCCGCTCTCGCATGGCCCAGCAGATAGTCGAGGGAATGT
GTCTGGGCAAGAAGAGCTGCACGCTTAATGTCAGTGAGGCGATCACTTACGCGTGGGAACCTGATGCCAACTACAGAACCAATTGCTCCAAAACTTCAAC
GATTATCACCATTGATAGCGTCGCTAACATCACCAAGGAGGTGTGTGAAGTGCGTCTGAATGACGATAGCGACTACTCGAAGTGCGATGACGCGTCTCGT
GCACTCATCGTGTACGGGAGGTGTTTCACCACTCGTGTTGACTTATCTAGTGCCTGGAGCCTGAAGATTATCGGTTGGGATTCCATGAGTGTAAGGGAGG
CAGTTTCTTCAGGAGTTTTGGGGTCTAACAAAGGTCTAACGTTGATTTGCTGTTTAGCGGCGCGAGTTCTTGGGGCTGGCGGTAGGGTGTGATATCTCCT
GTAGCCTCGCATTCTTTGGTGTTGTTGTTTGGCTACGACGGAAAGAGAAGGAAGCTGTAAACCGCATTGCCCAGAACCAAATCAAGGCTCTGGACTACAC
CGTGCAACTCGTGAATTTGCCGCACCATGACGATCTCAATCTGCTTCGACAAGAGGTGAGTCCACCATTATTCGAGGTGCTGGATGCACCAAAGCGTCGT
TCATTCTAACGCTAGTTCGGTCTGACTAGATCCGACTACATCTTGAAGCAGTCCTAAGTAACGCGCCACCATTCGCGGTGGAGCTTGATCGTGTGCGTGT
TGCGGACGTCCAATTCGGCAAAAGCGCGTCTCGCCACTTGCGTTTACTCGGTCGTCGTGGAGCTATCGTACGACACCTCGAAATTGCACAGCAGCGTCAT
GAAAAGCTAAAGCTGTTGAGTGGGCGACTGGATGAGCGCGTTTACGCCAGACGCGAGAAGCGACACTTAAAGGCTATCCACAAGCTAGAGACGAAGCTGC
ACGGCTTCAACGTCAAACTGGAGCGGTGGCATGCTCGTCAAAAACAACGAAATATCTCTCAAGCTGTCACGGCTTTCGTGACATTTGAAGAAGAGGAGGG
CGCCCACCGCTGCCTGCAAGAGTACCCGGATCTGGGATGGTTCCACCGTCTTTTTCAACCGTACTACAAGCGTCTTCATGGCAAACGACTTCGCTTTCGC
CCAGCCCCAGATCCGACCGACATCATTTGGGAAAACCTGCATCACCCGTTCTTTGAGCGTGTCTTTCGACAACTGGTACGCTTTTAAAAACCTTGGTACG
AGTATCTCATCGTCTAACGTGCGTTCTCCATATGCTGTCCGGCAGATTGTTGCGTTGATCACGCTCGCAGTGTTGTTTGTGAGCTTCTTACTGATCTTCG
CGGCAAAGGAGCAGAAGACCAAACTCGAAAGGCAGTTCGGCCGACCATCAAGCTGTCCTGTTGATGTTTTGAAAACCGACGTCATTCAAGACGAGCAAAA
CAAAGTTTCAGGGCTCATGCCGTACAAGGCGCTCGTTGAATGCTACTGCAAGAACTTCCTCACCTCTCAGTAAGTTCATCACAGTTTGCAAGCCTTCCAT
TCTCAAACTGTGTGCTCATGATCAGACTTTAACTTTGTGCTTCGCTTGATGCTATTACTCAGCTCTTTCCGCAGCATGATGTACGAAAGCTTTTACAACT
CAGAAACTGGAGAAGATGAAATGCTCTGTCGGACTTGGGCCACAACATTTGTGACGACCCAAGTGCTGTCCATTGCCTCGGTGCTGCTAGTTGTAGCTGT
GAACCTCATTTTGGCTCGCATTCTCAATGGTCTGGTCGCTATGGAGAAGCATCACACGCAATCGAGCCTTGTGGTGTCACGAGTCACCAAAGTCTTCATC
GCGCAATTCTGCAACACCGCGCTGTTGATGCTTGCCATCAATGCGAATGGCAAGTATTTTTCAGCTTCACCGACAAGCATGAGTACCACCGGAGGCTTCT
CAATTGGTGCACTACAGGTGTTGAATGGCGAGTATTCAGACTTTTCAGCGGAATGGTACAACGACGTCGGTGTGGCGCTCATGCTCACCATGATCATCAA
TTCGTTCAGCATGCACGCGTATCTCTTAGTCCAATACATCGTGCTCAAAGCTCGCCGCTTCATCGATCGAGGATACTCTTTCAACCACTCCCTCACCAAA
CAAGACACACAGCGTGATCTTGAGACACTATATCGTGGACCCAAGTTTGATCTCGCTGCACGCTATGCCCAATCGCTCACCTCGATCTTCATCATGTACA
TGGTAAGTCTGAATTGATCTCACATTGTCCCCACGCTGCAAAACTAATCTAGGGTTGCAGTTCTCGGCAGGAATGCCTCTGCTTCATTTCATCGGATTTG
GGGCTATGATCATGACGTACTGGGCCGACAAATTCAGTAAGCTGTCATGGTAGCGAAGACTTTATATCGTCCAGTGACTCACGTTTTCCAATGATCGTTG
CAGCATTTCTCCGTATCGCTCGGTCGCCACCTTTGTACGATGGTCAGGTTGCCACTGCGGCAGGATCTCTGCTTCCTTATGCAGTGCTGATGCACTGCCT
CATTGCCATGTGGATGTTTTCAAACGACCGCATATTTGAGTCGGACAGTGACGTGTCCAAGGAGGATTCCTCGGTCAACACCACCTTCAGCCCCGGTGAT
GGCATCCCATTATTTGACGCAGCTTATCGAGGTCAGTTAATCTCCCGCGTCACCCGCCCGCAGGTCGTCATCCTTTTCGCCTTCTTCGTGGCTGGCTGCA
CTATCGTGGTAATGCGCACCGTGCTCTTTGAATATGTGCCGGCGCTAGTACGCAGCGTTTTGCCAGCACTTGCTCGATTACTGGAAAATCCCCGTGTTGC
GAAGGGCATCCCTAACTACTTCGATGGTACGTGTGCTTCTTCGAACTGTTCATGACAACCTCTGATTGACTTTTCATGCTTTTAGCCATTCCGACGCCTT
GTCTGCAAGAGAAATTGGCTGCCACGGGCGGTACGCAACAACTTCTGCGGCCGGACCTGCGCGCCAAGTACGAGCGTGCTCTGGTTAGCCGGGTCGCACA
GGAGGAAGTTCTGTCAAAAAAGCGCTCGGTGCGTTCCATGTCAGCGACTGAGCGCTTCAACCAGGTAAACTGGATCGTCGGCTGTCATTCCTATGGTAAG
TCGCTCTTTTATCGCCATCAGCAAGCAGCAACCCTGACCAGTGCTTGTTTCATTCCAGCTATCAGCGACAACAGGGAGTACGTCGCGAAACTTGCCATCG
ACTCGCACCTCTCGGAGGAAATTCCACTCGATCAGATTTTCTAGGACGCAGGAACAACTCTGCCCTAGGTGGTATGGTACACGCGCTGGACGTTTATTAG
CGGCTTATTTCGTGAAAAAAACTCAACTTTCCCTACTCTCTTCGTCTTGTCGGCCCTTACACGCGGCATCTTGAACACATTTATGCCAGGCAGACTATTC
CAAGGCCTTGGGAGATGGAGAGGAGCCGTCTGCAGTTGACGACGATGGCGATTGCACACGCAGGCCAACGTCTGAAAGGTCAGACCTCTGTCCTGCGCGA
GTCTGAGATCGCGTATTGTTGCTTTGGTAGAAGCCCATCGCCATCTCGGTCTCGCCAGGGCAGTGCGAGAATGCAAAGCCGGTGTTGCGGCGAACGAGTC
GCGGTGAGTCCATCACCACAGCAGCGTCTTCCCCCTTAGCCAAACGATTCCACTCGCGCATCAGATGTGATGGCTCGGGGTAAAATAATACTCGCCCAGC
CTTGGCGATATAGTTCGGTAGAATGGCGATAACCACAGACAGCAAGAGGCCAAGCCAGAACCACGGCTCGCGAATAAGCTGGTCTACCACTCCATAGCCC
ACTTCCGTGTCGTAGAAATCAGCATTGGTCCATCCGAACACAGCACAGAAGAATGCCGTGAACAGGTAGTAAAACACCAGCGTGCCGACAGTTGCCAGAG
CGTTCGTCCGTGTCCAATTGCTCGTCATGAGCGCCACTTGCGCCGTCGAGGCGGTGATCAGGTACGTGTATGACGCCACACCATTTGCCCAAAGGCCTAG
GTCGCGCTTGTCAAACTGAAGCTTTGATGAGTCACTCGAAAAGTACCAGACGATGGAGCCGTTCGAAAAGAATGGCACCGCGTACACCACGTAAGCATGC
CACGCGCCCAATATGCACCAGCCAAAGAAAGTCAGCCAGTTGAACGAACGATTCTTCAGGCCGTTCACGTACAGCGTCGGGTACTGCATCAGCACTGCAG
GAGACACGTCCTGGTTGTACATGGCAATAATCACGATCGGAATCGTCGTAAACAGAGCGTTGTAAAGCGTAAAGAAGATGCTGAAGTACATCAGCAAACC
ACTGTACATCGTCTCCATCGCCAAGAAGAAGTTAGACATCGACAGCGCCACGTTCTTCATGAACGAGAACAAGATCAACTTGGAAATTCTCTTGTAGCTG
TAGTTGCCGTGCACCAAAAGAAGGCGCTTCAGGAAGTGAAACTCCGCGATAGAATAGTCACTGGAAAGAACGGCTTGGCGGCCCTCTTTACCACTGATAC
CGACACCCACATTCGCGGCTTGAATCATCGGCACATCATTTGCGCCGTCGCCGATAGCAAGCGTAATGTTGCCAGGTGAGAACATAAGCGTGGGTTCCGT
AACCAACTTCACCACTGACGCCTTCTGGGCGGGCGAGCAGCGGCAGCAAATCACAGATTTACATTGCGTGGCCACTGCCAAGAAGAGGTATTTGATGTCA
TCATCCAGCACCAGCGCCAACGTTTTGCCATCAATAACCATAGCAAACTCCAGTTCCTCGTCGACGTAGTCACCGCTGCTCATGCTGCCAGTACCACCCG
TCATCGTATCAGTTTTAGGCTCGAAATCGTGGTCGCACAAACCACGTTCGAAGCTGTTTTCGGAAATGTCACGGTTCGGCAGCGCAGGATACACTTCATC
GAAATGGACAGGGCTGTCCGTCGGTGTCGTATCATGTTCGCGTCGTGGCAAGCGTCTCCTCTTCTTTCGGGCCTCTGCTTCTTCGTCGCGTCCCACAAGT
GCCAGTTTTATAAGATCCCACAGATACAGAATCGCTCGCTTCAACGCTTCCCACAACACACTGAACGCCGACGAGGTCTCATCTGATCCCCATTTGTCTT
CAACAAGGTCGACGTACAGTTCTTCCAGCCGAGTACGAAGCGAGCCCTTGTCGCGCTGGCCCAGTACAATCACATCCATATTATCATCGATCACGTGTGA
CGACATGCCAATGCTGAGCGCTGTTTCCTTCTTGTCACCCGTGAGCACCCAGAACTTAATACCAGCCTTGCGCAAAGCACAAATAGATTCTTCCACACCG
TCCTGCAGTCGGTCTTCGATGGCTGTCGCACCGAGCAGTGTCAACTCAACCTCAATGATAGCCGAAACCTTGGCAATTTTTGCGGCACGTCCCTCCATCG
AAATTCAGCCTGTCGGTATAGGCTGCTCCACTGTTCATACTCCTCTTGGGTAAGGCGACGCATTGCAGTGGTAAGAGTTCGAAGGCCTTCCGACGCGTAC
TCCTGAAGATGACCACGCGTCACATGCGCCACACCCTGTGGCTGGGTCTTGGAAAGGAGATCGAAAATGACGTCGTCTGCACCCTTGCAGTAGAGCACAA
TACTACCATCGGGAAATCGTACAACCACTGACATTCGTTTCCGATCGCTGTTGAACTCTAGCACGTTCAAAATCTCAAACGACATCAGTCTTCCTTGAAT
GAGAGCATTGCAAATCGGACCGTCGCGTGATTCAAGAACGTAGCCGAGGTCACTCGCAGCCTGTACAAGTGCCTCCTCGTCAGGGGAAGACGCATTGTAT
TTGATAGTTGCTGTCGGCGCCGAACAGGAGTCGCCAGTGGATGTAGGCGATGCGGGAACATTGGTCTCGGGTATCACGGTGTTGCAAATGGTAAGCAGTA
GTAGGAAATCGTGGATCTCCTTCTTTGTCGAGTGGTTCGAATTGAGACGCGCCATCAAGCGGTTATCATTGAACCGAGTTCCAGGTCGCGTGGGCTTTGC
AGGGTCTACTTCGATGTCATTGTAGCGCAGACCAGCCACAGTACACTTCGCAAAGATCATTTCGTTGCAAGTGAGTGTGCCTGTCTTGTCCGAGAATATA
TACTGAATCTGGCCAAGATCTTCGTTGATGTTGCTGTTGCGAACCTGAGCTGGCGTATCTGTCTTGGTGTCGTACATCTCGAGATCGTTTTCAATGTAAC
GTGCGTGAACAAAACGCACGCCTTCCATCGTCACGTACATGGAGAGCGGGATCAAATTGTTGAACAGGATCACGTAACTCAAAAAGATGTAACCGTTTGA
GTCTTCCTCGATGTACCAGGGCGTTGTCTCGTCAGCCAGGTCAAGGTTCCAGTTGTTGTTGCCCAACGTGCAAGCAATTGAAATTCCAAACAGTAACATG
AGCACCAGAACGAACATGGTGTCCAGGGTCTTCTCCACAAAGCTTCGCTTGAGAGGCACAGCCGTGGAGTTCATCTGGACCTTCGTCTCCTTGCCCGTGT
AAATCACGAGTCCCAACGTCCATTCAGAGTTGCGGCTCTCACTGCCACGCAGAAGCAAGTTGTCCATGGTCAAACTTGATTCGTTGTCGTCGTTGTTGGC
ATCTGCAACCGCATCGTCTGCTATCTTTCCAAGTCTCAGCACGCCGTCGAAATAGAACAGGTCCTTGTTGGGCACGTCGCACTCCACCTGGAGTTTGTAC
TTCTCCAGAATCTCCTCTGCAGTCATAAAGTGCTTCGTGCAGCTGGCTACCTGGCGGATCTTCAGGTTAGTTTCGCCATCCAAGTTGGCCGTCTCAACGT
AGCATCGGCCGTCGGGTCGACTTGTCGCCAGCAAAATGCAGTCAGCCGGAACCTGATCGCCGTCCTTCAACATCAGTACATCTCCCACTTCGATATCCTG
CCAAGTGCCATCGATGTGCATCACCTCATTCACAACGTCGCGGCGAATAATGTGCGCCGGCCTGGAATTTACCATGGCGTCTCCCTTTTGGCGACGCAGG
TCTTCGCTCACGTCCTTGAGTGCAGACGTCGCGAACACGATCAGCAATGGCGTCAGACTAGCCACGGGACTCACTGGCGAAAAGTCGAAGAAACACAGCG
CCACCACGATGGTCGTATAAAAGTTGGCGAGTCGGCTGAACTGCATCTTGAGGAACACGAACAGGAAGTTGTAGTACGTGTACTTGCTCGTAACGATGAG
GTTGGAGGAGAAGACAGGAGCCTCTTCCTGGGCTTCTGCCTCCTTCCTGCGCTGCTTCTTGGTCTTCAACGCGTCGGGCAACGTCATCGACACACCCGAC
TGACTGCGTCGCAACCTGTTGTTGGGGATGCCCGGGCCCACCACAATCTTCCGTCTGGCTGACGGACCTTCATCCTCGTCCATCTCATGGGTCGACGGGT
TGATGGACAGCGTCTGATGCAGCGAGTTGGCCCGCAGCGGGGACGGCATCATCGTGGCGAGAGCTGCGCGGTCGCACTCTCGCTGGTTCTGCACGGCCTT
GACGATGCGGCGGAGTTTCCAGCCGTACATGAAACCCGTGATGTTGAGCATGGTGAGCAAGATGGAGAAGAAGCCCTGCATAAGCACGGACGTGCCGCTG
CTGACACTATTGAGCTTGCCATTGTAGCCCTTGTAGTACCAGATGACGTCCACCAACAGCGTGAGTTGCATGCCGATCTTGTAGCTGAGCAGGAACTTGG
GCACGAGGAACTTGGTGCCATGCCAGCCCAGCACGAGCGTCACGTACAGGATGAGCACGGGCACCGTGGCCTGAAAGCTCAGGCCCAAGATAATGGGGAA
AATACGCAGCGAGTTGATGACCGTCTGCGACACGATCGTGAACTTGAGGCGGCGCCGCGTCTGGTAGATTGTCATGCCCTTGAGGAAGCAGAAAACCTTC
TCGAAGAGGTTCCACACCTTGGTCTCGGCGTTGGGCTTGGAATCAGACGCCACCGAGTCCGCCATACTGTCAAATGTCAACAACAAAAAAGGCGTCAGAA
ATGATTAGTTCACGTGTCAAAATTGTCTTTTTTTCCATTTTCCCGTCGAACAAGTCGATGTGCTTGTTTTTAGGGACGAAGGGTGTTGTGGGATTAAGCA
CGGTACCTATCGGCACGATACCGCAGCGAGATGATGTTGCGCTGCTCCTCCTCGTTCGGGACGCCCGTGAACGTGTTGATGCGCCGCAAATTCTTGTGGG
CGTGTGACTGCGACGTCGGCGGCGGCTGCGCGCCGTCAGCGGAGGAAGGTGCTGTCTGGCCCATGTCCAGCGTGTACTCTGTGGAGCTGTCGGACGGCGA
GGGCACCGCGAACTCGACGCGCATCTTCAGTCCGTTGCGAAGCCGCTTGGAGCCTATTCTTGAGCCGC