Description :
From Genome Similarity Track
Location :
contig_9:243754- 245420
Transcript NameFunction/comments
g2621.t1hypothetical protein

Sequence
1666 bases(100 bases per row)
TGCAGTACGCAGACTTAGAACAGCACAGCATGAACAGCTTAGCCCCCCAGCGATGAGGCTTATCCTTCATGAAGATCCTCATTCGGTTGAATGGAGACGA
GCACGGAAGCATTGCCTCGTCAAACGCCATCACTGGTGGCGGAGTGAAGCTTCTTTGGAAGGTATCCTGCAGGACATCGATGACCGGACGAAGCTTCCAG
GCTCGGTCGGTGACCGCACGATCGTCACCATTGCTGCTGAAGTGAAGATTGCGCGAGATGTGGTCGAATCGATCTCGTTTCATGAAGTTGCCAAAGCCTC
CGCGTGGGATAGCGCCTTCGTCCGTATTCTTCCAGTGGTGTGCGAACTTTTCTCGGTTGGGCGCAATGGTCCTCGCAATCAGCAAACCAATGAAGCAGCA
CAACTCTCTGCCTGAGATTTTCAGAGTCTTTTGTAGCTTCGTCTTGATTTGTTCAGGGGCTTGTACCTGGAAGTCCGGTCGCTTGAGCTTGCGCGCTTGC
TGCTTGGCGTGTTGGGCTTCCACACGAGCGTCCAGGTTTTCCGTAAAGTAGGTGTCACTCTCTCTCCCGATCTTTGCCAACAGTTGCGGCGTCACGAACC
GCAGGAACGCACCGAGGGGAGTAGATGCGGCCTGCAGCGCACTAGCCGTGGGACCGTTAGGGCCGTCATAAATACCCGGATAGTCTTTGCCGAGCCATTC
ATCTGGTCGCACTTTATACGGTTCGTCCATGTACGGCCATGGTGTCTGAATTCGAGGCACTGTCCAGCCATTCACAGCCATGTCATCTAAGACTTGTTTG
CGTATTGTGCCGCTGGCCACAGCATCTACACCTCCCACAGCTGTGAGCAGCTGCGGGTCAAAGTGCAGGTCTGGCGCATTGTGAGCGTCGTCGTCAGCAT
CCAGTGTAGCCCAGTCCAAGTCATCGTCGTCGCTATAGATTGAATCTCCTTCGCCATCACCGTCCGAATCAAGCGCTGTGTAGTCTGCCAAATTGTCGCC
TGGAGTGGTGATGTTGGGGTCGTTTGTGAGCGTGCCTGATACAACCAGTATATACAAGATTAGAGTTATAACATGTATCCATATCGTGTATGTATGCATG
CCGCACTAACCTGCGACTTGACTGTCACCCTCTTTGGTTTCTTCTTCCTCGTTGTGTGAACTCCTTACGACACCAGTCTCGTCATCATTAGACCCACGTT
CTGAGTCCTCGTAGTTGATGTCCGAGTCTGCCAAGTCGAAGAGGTTGCTGAGATTACGCCGTGATGACATATATATCAGGAAATCCAATCCATCGTTAGT
CGTTACTACTCAATACAAAGCTGCATCGCGTAATGCGTACCATTGGTGTCGTTGTTAGCGTCCAAATCCTCCTGGCGTGTGCTTCTGCCGCTTGAATCCT
CGTCCATCACGTGGGGCGAAGTGGCAATGAGGATGTTGTTTGAGACCGGATACGCGGGAGAGTTTGCAGCTAATTTCAAGAACGTTAGCATCGCACCAGG
TGACATGAGTCTATACAGCAGCATACCTGCAGGTGGCGTACGCTCCAGCGGTGCGCGGCTTTGGGTTTGATCCAGATCTTTAGAATGATCTGTACGATAC
ACGTTAATGTCAGACAACTAGCGTGTATAATACCGGCAAGTCATCACATCTATACCCGTCCGTTCT