Description :
From Genome Similarity Track
Location :
contig_9:243725- 245391
Transcript NameFunction/comments
g2774.t1hypothetical protein

Sequence
1666 bases(100 bases per row)
AGAGCCAAAAAAAAGAGAGCGTGCCCCAAGGCACGCTCTCATTCTTACCGGATGCAGTACGCAGACTTAGAACAGCACAACATGAACAGCTTAGCACCCC
AGAGATGAGGCTTATCCTTCATGAAGATCCTCATTCGGTTGAATGGAGACGAGCACGGAAGCATTGCCTCGTCAAACGCCATCACTGGTGGCGGAGTGAA
GCTTCTTTGGAAGGTATCCTGCAGGACATCGATGACCGGACGAAGCTTCCAGGCTCGGTCGGTGACCGCACGATCGTCACCATTGCTGCTGAAGTGAAGA
TTGCGCGAGATGTGGTCGAATCGATCTCGTTTCATGAAGTTGCCAAAGCCTCCGCGTGGGATAGCGCCTTCGTCCGTATTCTTCCAGTGGTGTGCGAACT
TTTCTCGGTTGGGTGCAAAGGTCCTCGCAATCAGCAAACCAATGAAGCAGCATAACTCTCTGCCTGAGATTTTCAGGGTCTTTTGTAGCTTCGTCTTAAT
TTGCTCAGGGGCTTGTACCTGGAAGTCCGGTCGCTTGAGCTTGCGCGCTTGCTGCTTGGCGTGTTGGGCTTCCACACGAGCGTCCAGGTTTTCCGTAAAG
TAGGTGTCACTCTCTCTCCCGATCTTTGCCAACAGTTGCGGCGTCACGAACCGCAGGAACGCACCGAGGGGAGTAGATGCGGCCTGCAGCGCACTAGCCG
TGGGACCGTTAGGGCCGTCATAAATACCCGGATAGTCTTTGCCGAGCCATTCATCTGGTCGCACTTCATACGGTTCGTCCATGTACGGCCATGGTGTCTG
AATTCGAGGCACTGTCCAGCCATTCACAGCCATGTCATCTAAGACTTGTTTGCGTATTGTGCCGCTGGCCACAGCATCTACACCTCCCACAGCTGTGAGC
AGCTGCGGGTCAAAGTGCAGGTCTGGCGCATTGTGAGCGTCGTCGTTAGCATCCAGTGTAGCCCAGTCCAAGTCATCGTCGTCGCTATAGATTGAATCTC
CTTCGCCATCACCGTCCGAATCAAGCGCTGTGTAGTCTGCCAAATTGTCGCCTGGAGTGGTGATGTTGGGGTCGTTTGTGAGCGTGCCTGATACAACCAG
TATATACAAGATTAGAGTTATAACATGTATCCATATCGTGTATGTATGCATGCCGCACTAACCTCCGACTTGACTGTCACCCTCTTTGGTTTCTTCTTCC
TCGTTGTGTGAACTCCTTACGACACCAGTCTCGTCATCATTAGACCCACGTTCTGAGTCCTCGTAGTTGCTGTCCGAGTCTGCCAAGTCGAAGAGGTTGC
TGAGATTACGCCGTGATGACATATCTACCAGGAAATCCAATCCATCGTTAGTCGTTACTGCTCAATACAAAGCTGCATCGCGTAATGCGTACCATTGGTG
TCGTTGTTAGCGTTCAAATCCTCCTGACGTGTGCTTGTGCTGCTTGAATCCTCGTTCATCACGTGGGGCGAAGTGGCAATGAGACTGTGGTTTGAGACCG
GAGACGCGGGAGAGTCTGCAGCTAATTTCAAGAACGTTAGCATCGCACCAGGTGACATGAGTCTATACAGCAGCATACCTGCAGATGGCGTACGCTCCAG
CGGTGCGCGGCTTTGGGTTTGATCTAGATCTTTGGAATGATCTGTACGATACACGTTAATGTCAAA