Description :
From Genome Similarity Track
Location :
Scaffold_8:243678- 244932
Sequence
1254 bases(100 bases per row)
CCGTGTTACAGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTACACAGACCACGCGTCG
CTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAA
GACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCGTGCGATCGAGCACCCCAAC
GTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGACCTATGGCTCAGCGCCTTCTGACAAAGCTCGTCAG
AAGCTGTCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCG
TGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACAGCGGGGCATCCGGGTCGTGAGAAGACATACCTTCATCTCAC
GCGAGACTTCTACTGGGCCCACAGTACAAATGGGCGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTC
CCTTGCAGTCACTGCCGACTCCGTCGGAGTGTTGGCAGTTCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGT
GGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACCGACGGCGCGTCTGTTCATTGACATGGTGTTC
AAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACTCCTTTGGCAAGAAGTGTTTACACTTCTTGGGGGTCAACTTT
CGATGCCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTTCGCTCACTCGTTCCAACA
CTGGAGCGAGTGTCTGCCGATGGCAGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCAGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCA
CGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCT