Description :
From Genome Similarity Track
Location :
Scaffold_520:24366- 29484
Transcript NameFunction/comments
Phypl_g9098hypothetical protein
Phypl_g9099hypothetical protein

Sequence
5118 bases(100 bases per row)
AAATCAACTTCTCGCAACTCGTACAGCACTGAGACGTAGATCGCATAATCTTCGACAAAGCGGCTATAGTAGTTCAGGCTGCCCAGGAAAGATTGCATAG
ATCGTAGTGACGCCGGAAATGGCAGATCAGTCAACGCCGTCAGGTCTTTGGGTTTAACCTCCAACCCATCCTTCGACACTCGGTGTCCCAGGTATTCTAC
CTTGTTCATTCCCCAGAAGCTCTTCACCACGCTGATCGATAGGTTCCACTTGTCACACGCCTCCAGTAGGGCATCTACTTGATCGCATAGCTGATCCCAT
GATCTCGCCGGGATCAGTATGTCGTCGATATAAGATCTACGTCCCAACACCGAAGGCTTACCGGGATCTCCAGGTTCTCCTGCCTCAAACAGATCTGTCA
GTTCCCCTTTAGCCCCAGAACGCAAGATCCGCGTAAATCCGTACAACGCATTATCGATTAAGCGCTGATAGATCTGCGGGGAGTTCTTGAGGCCGAAAGG
CATCCGACTCCACTCAAAAAGTCCAAATGGGGTGATGAATGCCGAGATCGCACGAGCTCGACCCGTCATCGTCACTACCCAAAATCCGCTCGCCATGTCC
AGCGAACAATACCACAGCACCTTATCCAGATCTACGAGCAGATCGTTGATCAGAGGCATTGGATAAACCATCAGTCGAGTAAGGCCGTTGACCAGTCTGT
AATCAATACACAGACGTATGTCCACaccgttcttcttgatgatcACGACGTTTGGTGAAGCCCACGGTGACGTAGAGTGATGTATGATCTTGGCTCCCAG
CAATCCTTTGATCATATCTGACAACTTTTCACGGAACTGTGGTGCCACCTTACGGATTCGCTGTGCGATCGGCCGTGCGTTGCCTACGTCGATATCACAC
ACGACCCCCGCGCCGCCGGAGGCAGCACATTGTCTTTGCCGATCAGCAGATGTCGACATTGCCAGATCCATTTCCGCAGGCGGTCGATCTCTTCCTGTGT
GTTGTTTGTGGGATCTCCCACCTGAAGATCTTCAATCGTCACCTCGTCGGTCGTCAGAGTGACCTCAGGTACCACCGCCAGTTCACCTTGCACATCTTCT
GCGAACAGCTCACCACTCTCGTGATAGCAGATCTGTTCATCTTCCAGAGGCACATCCTTTCTGGGGTCTTGATCGGGCAGTGCCATCGGGTCTTGATCTA
GCCTCTGATCATCGCCTGGTGTGTCCGATGATGTGTCTACCTgctccgtcttcgtcgcaTCCGCGGCGATCAGCGACCGCATCATCCTACTGGGCAGGAT
CCTCCTTAATTTGTCTGTCCGTCATCTGATCTGGGCTGGCTATGTCGCGAGCCAGTTCTGGCTGCACGTAGCTCGCAGCGAATGGACTTGGAGATCCTTC
AGCTGTCCTTTCCACCGCTTGATCCTGATATTCGACCCTTTTGACAACACTCGCCTTCGTGATCTGTACCCATCTTGACTGCACTGCTTCGACCGCCACT
TCATCTGGCGGCTGGCTAGCCTGGACGGGCTTCGCCTCGTCTGTTTCTAGTCGGATCGGCGTAATCATGCCTCGTCATAAGATTGCGCGAGGCGTGACGT
ACTTCGGGCGATCGACAGCTGGCACTGGTGGTCCTGTTAGCAGATCTTCCTCGGTGTTCCCAGCTTCAGTCGTAGCCTCCAACGCCAGATTCTACCACTC
CATGTAACGATGAGATCCGACCGAGACGAAGCCTGGAAGTCGCGGGACGCGGTCTCCGGCCAGCCACATCCCGATCCGCTCACCGCCTTGCAATatcagc
ttcttctcacCGAGGTTGGTGATCTGGAGGTATCGCGTCTTGTCTAGCCCCTTGATCACACTTGGCACCCAGCGGTCTCCACGCGTGACCCATGGTTTCT
CGTGATCCGACGTACGTAGGCGTAATGAGAGTTCTACGGACTTCCCATCCCGATCTGTAAGTACTGATCCACTCTCAAGAGTTTCACCTTGCCACTGTAG
AGCTGTCGGCGGCCGCTCAGTTGGATCTTTACTTCGTCGGGCAGGCAGATAGACCCATCGGCCAGATCTAGTCGGATCCCCGCCGGGACCATGAAGTCCA
TACCCAAAATGGCTTCTTGGCCGGACAGATCACCCACCCATATGTCGAAGAAATATACCAGTGATCAAGCTAACGTAACCTTGATCTGCGTCCTTCCTTC
CGTCCTGTACACGTTTTCACCGATTCCAACACATTCCTGGCTCTGACTTCTGTCCACATAGCACCCAACCTTACGAGCAAAGGAGGTGTCCATAATGGAC
ACCTCGGCACCAGTATCCAGAAGCAAGATCGCCTTCTCATTGTTGATCTTGCCGGTGATCTTGGCCTGTCGAAACCATTTTCCAGGTGCGTGGTGTTTCC
AGTATCCTCGAGATTCTCCAGGGAGAAGTCCAGCAGACTCCACGACACCAGATCTGCGATATTCATCGGTACGGGGATTTTAACGGGTAGCAGCGATTTT
ACCTTTGTCAGGTACAAACTACTGATCTGGATCCTGTTGTTTGCAGTACCCTCTTGGCTCTCCGGGGTGGAGATCCAGGGATATGGAGACATCAGATCTG
ACGTACTCATCTACTTGGCGTAGACTCGCAACTCCCACTGTACGTTTCTCATGCAGATCACATGTATTACCGTGTAGATCTTGTCGATTGCTAGCTTGAT
CTACCGATTTCTTGTTCACGAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTAACGGATTCCAACCCGCCGAGCGTCCTAGTTTAACATATTCTCG
GCCATCGTAGGCAGCATGCCTGCGTGCTTCGTCGGGTTGTACCACTGACGGATCTGGTTGTAAAACTCTTCCATCGGGCACTTACCCATGTCGTGAAGTT
CTCCATATCCTCGGCACACGAAAGGCAGTGATCAGCTGGATGACCTCCCTTTCCACACTTCTGACATGTCAGACGCCTCCAACAATCACGATCCGTGTGC
TTGCGAGATCCACAGCGCAAACAGCGACTGCGGTCTGATCCGTCACCGTAGTCCCGAAATCTACGATCCCGGGGCGCTTGATCTGAGTTCCGTCGGCTCT
CTTGGCTCGGGTTTGGAGAACCTCCGCCAGCCTCTGGCTCTTGCGTATGCTCGTTGTCAGCAGCCAGGTAGATCCGACGGTAATCATCATATTCTGAGTC
AGATCCGCTTGATCCGGAGTCTGATCTAGCTTCGGGGATCGAGGCCTGGATCGCGCGGACATGTTTGGCTGGGGCTGCCGGTACAGGGGTCGGTGTTTTC
TGACGATACTTGCTAGGTCCGAACGCGGACTTCTTCTGGCGGTTCTTGGCGCGTTCGAGTGCGCGGAGGACTTCTTCAAGTTCGTCAGCATCCGGCAGGC
GTAACAACGTCAGTCGATCTGCCAGATCCTGGTCATTCACCGTCTCGATGAAATGATCGACATGCTCGCGCTTGTCCTTTGGTCTGTCATTCTTGATCTT
CAACCTTGCGCGTAACCCGGCGACATTAAGTCGGTAGAGGTATTCCAACGATGTTTCGTCGGATCTCTTACGCGCGTGGTAATACTGTCTCGCGACAGAC
ACCGAGACCACAGTATTGGATCTGGAAACCACGCAACAGGTCAAGCCATTTATTTCGGGTAGATCTGCTGAGCTGGCGATACCAGTTCCTGGCAGGCCCC
GACAGCAGATCAGCGAATGTCAAACACTTCTCTTCGTCCGAAGCCTGATCTCTCATGAGCGGTGATTTGACCTTGCCGATCCAGGCTCTGGCGCGATCTT
CGTCCTGGTCTTTACCCGTAAACTCCTTGAGATCTGAGATTGCGGAAATACGGACACGTTGGATCATTGAGGAACTCGTTGATCCTGCAGTGGCCGTTGC
TACTGCAACTCGGGTGGTAGCCGGGAAATCTAGATCATCCGGATCGTACTCCCAATGAGTTGAGTCCTGTACTGGTGATCCCACCGACTCCATCTCGACA
TCTTGTGATCCACGATCTTGAGGCGTCTTGGTTGCAGGTacggctgctgccacttgttGTTCCGATATCGGCTCATGGCGGCTTGGAAGTACTTTGCAAC
GTGCCAGGCGACTCGTCTGGGGTCGCAGCAGTTCCGATCTGGTTCGTCGAAGGAGGTGCCTTTTTCCGGGCACTAGATCGGGGACCCTGACGTCGGATCT
TCGATCGCGCCTCCAGTAGCGATGCACCAGAAGGGCTGAGCACCATTCGTCGGGGTTCCGACGAGGTATCCGAACCATCCTCGGCTGCCGAGGCATGGTG
CGGCGATGCCGTTGCGCTGATCCGGGATGTCGGCTCCTAGATCGCCAGATCTAGGAGCTTCACCGACCAAGATCTTCACCTTCCCGAAGATGAACCGCGT
GGCGCACTGCAACGCGTCCAGATCCATGTCGAACAGATCGTTCGCATCGAATGCGCCGGCGAGTATGCCTGCTTCCTTCAACAACCGTAGTAGATTTTTC
ACTACCTCCATCTTATTGTTTGTCGTCACAGGAGCCGTCCTGGGTTCCTCAGGATCTccgatctgcttcagcttcaggaTCTTCATCACTGGATCTTGAT
CTAGGAATTCGTGTAGCTTCCTGTGGTGGAACATGTGCTCCAGGGCTTCTGTAGACCACCCGATTGTGGGTTCGGTGTGATCTTTGTCTTCTGCGTCTGG
AGCTTTCATCTTCAACCGCGTAGTCTTCGTCTTTTTCTTTTCTTGATCAAATCGTGAGACTAGCGGGATCTTGTGCGGGTACGGCGTTTGCTTGATCGGC
GAATCCGCAAATGCATACCGTTCAGCTTTCGCGGTCCGCTCTTTTGTTGGCAGATCTCGACGCGAGTCGAGATCCGCCGGGGTCCCCGAAGGAACCTGTG
GAGGAGATTGAGGTTTCTCTTCGAGATCTGTCGCCAGATCACCCTCTATTCCGTCAACAGAGTTCCTGCCAGCACTCTGTTGATCCGCGGATCTTGCTTC
AttcagcggcgtcgtcgtcgatccgATGTCCGATGACGCTTGTTCCCCTTGTTCAATCTTCACTTGAACTTCATCTTGAGACTCACGGTGAAATCCCGAG
TCACCAAAAGATCCGGGC