Description :
From Genome Similarity Track
Location :
Scaffold_108:24363- 25426
Sequence
1063 bases(100 bases per row)
TTTGCGTTGAACAACGCTGTTCATGCCTCGACAGGCTATACTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTG
GTTCAGGGCTTGGTGAGGGAGAGGTTGCCGATCAGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAACAGGTAGGCGAGTTTTTCGCAAACGCGATTAA
ATGTCTTAAGACATGTGCGTGACGCAATTGCTGAAAGCCAAGATCAACAAAAACAACAAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATCAGGT
CGGAGACCAAGTATTACTCAATACTAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTCAAAACAAAGTTGCGTCCGTGCTTCATTGGAACATTCACG
GTCACTGCCAAGAAGGGAGTTGCGTATACGCTCAACCTTCCACGCAAATTGTGCACACATCCGGTGTTTTACTTGGGCTTGCTTAAGCCGTATCGGGATC
CGTCCCACGTGAACTAGGAGGCGCTTGCGCCGCGGAAGTTGGCCTTGCCATCGGTTGCTGCATCCGAATCAAGAGATCAAGCTGGACCTCCATCCGGGTG
TGGCCCGACTCCAACGCCTGAACGCGAGCTTGCGTCGCGTCGAGCGCACTCTGGGTCTTACCCAATGTCTCACGGAGACCATTCAGCTCGAGAAGTACCC
TATCATGCTCCTCCTTCGGTACACCGACCCCTACCGACGCTGCTCGGTGCGAAAGAGAACCGCCAGTTCCATGTGGAGAGACTCCTGAAACGGCTTCGTC
GCCATGGCCAATACCAATACCTGGTAAAGTGGCGAGGGTACCTAGAGTCGGAGAACTCATGGGAATATGAGATTTTCCTTCGGCAAGACTGCCCAAACGC
CGTGGATGTTTTTGAGCATCGTGGCCAGGGTCATCTTGGGACCGAGGCCGTTTCCCACCACTAGTGGTGTCGATTGGTGGGTTGTTGGTCACAGTCTGAC
CAGCACCCGCGGCTACCGTAGTAGCCAAAGAATAGCGCGTGCGATTGCGTAATTGGCCTCTAG