Description :
From Genome Similarity Track
Location :
Scaffold_938:2436- 4152
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_938-snap-gene-0.2Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_938-snap-gene-0.3Calcium-binding protein CML8

Sequence
1716 bases(100 bases per row)
ATAAGGTGACGACCGAGCGCGACCAGCTCCGCTTTGAGCTTGAAAAGGTACGATCATGACCACGTCTTAGCCTCGTATGGTGGACCGGATCATGCCCATT
GCAAAGCGCTCTTGCTTACTTACGTGTGCTGTTGATTAGATCAAGCGTACGCTGACGTCGACCGAGAGGAAGCTTGCAGAGGCCACGAAGGCGCGCGAGG
CGCTGGAGAAGCTTAAGGCGCATTGCGAGTCGCTGCAGGAGTCGCTCAACCTCTCGGAGAAGATTCGCGTGCGCCAGAAGAAGCTGCTGCAGCAGCTGCA
GCTCAATCACCAGCAAGCGCAGGTTCAGACTCAGCAGCCCAGTAAAAGACCAGAGGCTGTTTCGCAAGCGCAGAGGACTCGGGAGCCCTCGGTTGGGCGA
TCAGAGGTGGCAAAAGCGAGGAAGAATACACTTACCAGTGCTATGAATGGCAACTCAGTTCATGAGCCAGTCAGATACTCAGCTCAGCACCAACAGCATG
ACTCGAAGCACCACGAGTACGACATCCTGGACTCGCTTGTAAACCAGCCAGCGCGTACGAATTCAAGACCCTCCGCCCACGGACAGCAGCAACGACTCGG
TCGTCGCACTGCGCCTCTCCCAACGACGCGCTCGTCGGTGTATTCTGGGACAGTCGTGTCTTCACCTCGCTCGGGTGGGGGCTACACGTACGCTGACTTT
GACAGTCTGCTGCAGAAAGTGCACTCGCCACATCCGTACACCTTTCTGCCATCCCAGCCCACGTTGTCATCCTTTAAGCAGCAGGCGAGCGGTCGACTTA
GCCGTCTCGATCAACCAATATCAGCTCTTCCTGCGAGGCGCATTCGATCCAAGTCGCAGGGTCCGCCCACAACGACATCGCGGCCGACAAGCGCGAGCTC
TTCTGCGAGGATGAAGCGCAGCACCAACCACTTTCTCGCACCGACGCAGGCAAGTCTCCAGCGCACTCAGGCACAGCAGCGAGCGAGAACCGAGGAGCAC
CGGCGGCCGTTCATTTAGTGACCAAGCACGGTGAGTTGTCAGTGAGAATTCCAGCTAAATTGGGGTCTCGTGAAGACAAGTCGATGTTCAGTCTCTAAAA
TAACCAGCCTCTCTGCGGCCATCGACACTGAAGCCATTCGAGCCAATGCGGGTGCTGTAGAGCGGTGGTAGTTCAAGATGAGCGACGCGCTCGTGGAGAA
GACGTACCAGAGCCTACTGGCAGTCGTGCAGACGACGGCGCTGAGTCGTAAGGTGCTACAGCGACCGCCGTTCACGTTTCTGCACAAGCTGCTCGTCGAG
ACGCTCGCGGACTATGACATCTTCACGTACCAGCAGCTCGAGTTCGCGGAGCTCGTGACCAAGGAGGACAAGGCAGCATTCCTCACGCGCGCGATCGCGT
TCGTGACGTTCGCCATGGCCGCGATCAACAGCAAGCGCATCTCGTGTCTGCTGCTCGTAAGCCCCGTCAAAGTGCTCGCGGGGGTGGCTGTGGAGGACAC
GCACGAGTTCCTACTGCAACTCTGCGAGATCTGCAAGTCGCCGGACCGCGAGGCGAAGGACGCGGCCGCGCAGGACGTGATCTCCAAGGGTGACGCGCAG
CTGTATATGTCCGGAGTCTCGTTCAGGAAGGGGCTGCTGCTCGTCCAGGCGATCGTGCGGTCGTTCATCAAGCGCCGCGCTGGGAAACGCAAGGCGCTGC
AGAGCAATAGTGCTAG