Description :
From Genome Similarity Track
Location :
contig_60:243595- 253161
Transcript NameFunction/comments
g9099.t1hypothetical protein

Sequence
9566 bases(100 bases per row)
ACCCAGTCCAACGCTCCATTCGTTTCTCGGAGCACTTGTATAATTATCTGATCCCCTGCAATTGCAACCGTTGGTAGCGAAACTTCCGACACTGGCGCAC
ACCAATTATTGCATTCACGGCACACTACCAAGCGCGACCCACATCTGATGATATGGTGAACAAACGCAGCAAGAACAGGCGACGGGCCTCCTTGTCGACC
CACAACATCCAGCGTGCTGCAAACCCTGAACGCCGCCGCAGTGAAGCTACAACCTCTACGAAAACGAGCGAAGTTAGCTCTGCCGAACCTGTAGCCGAGA
ACGCCCAGCTTTTGCCAAATCCGCTGAGGTTGACTAATGATGGAGATATTACAGCAATGGAAGAAGGACAGCTCAAGAATGACAAGAAGATAAGTATTCT
CTTGTCGCCAAGGCTGGATGCTCAACTTGGTGGATACCCACCCGATTGTGGCACCAAGGAGCTGAAATACCTCTCGTACGCCAAACTGGTGCATGATCGT
GGAACGACTCACCCGATGCGTTACTCAACGACCCACGTGGACGCACTGGGTTTCGCCATGCCAGAGCGATATCCGTTGTTTTCCACCGACTTTGGCGCTC
ACTCTTTTCACCACCTGCCGACTGACTCGGTTGTTCTAAGCCAGTATGGCCTCGGGGTCGCGCTTTACTTTAAGTATCTTAAGGTCATCACGTGGCTTTT
TCTTCTGCTTGCCGTGATCAGTGCTCCTGCCTTAGCAGTCTACATCGTTGGCGGCGGCACTTCTATCGCGGAACTTACTGCTCTCGCACGCCAAGACCTT
CCGTCCGTCTTGGGAATTACCAGCATTGGCCATCTCAGCGAGGCCACCAGTGTGTGTGATCAAGCTTTGGAGAATGCCGAGCTGTCACTCACGTGCTCAG
CGGGTGAGATCGGATTTGTCAAGGCAGTGTATTCGACCTATGACACCCAAGGGTCCTGCACATGCCCCGAGCGCAACAAAGTTGCTGAGGGTTCTGGGAA
GTGCCGAGGTGACGCAGAAGGATCGGTTTGCCCAGCGGACGGTCTGGGTTGTTTTCTAGGCGTGCACCCAGTCTCCCTTCGTCCTTGCTGCTCATTTTCA
CAGAATACAACGACTAAGACCCCATGGTTTGACGACATGCGCATTCAAGCGAATGAAGGTTGCGGCTCTCGCATGGCCCAGCAGATAGTCGAGGGAATGT
GTCTGGGCAAGAAGAGCTGCACGCTTAATGTCAGTGAGGCGATCACTTACGCGTGGGAACCTGATGCCAACTACAGAACCAATTGCTCCAAAACTTCAAC
GATTATCACCATTGATAGCGTCGCTAACATCACCAAGGAGGTGTGTGAAGTGCGTCTGAATGACGATAGCGACTACTCGAAGTGCGATGACGCGTCTCGT
GCACTCATCGTGTACGGGAGGTGTTTCACCACTCGTGTTGACTTATCTAGTGCCTGGAGCCTGAAGATTATCGGTTGGGATTCCATGAGTGTAAGGGAGG
CAGTTTCTTCAGGAGTTTTGGGGTCTAACAAAGGTCTAACGTTGATTTGCTGTTTAGCGGCGCGAGTTCTTGGGGCTGGCGGTAGGGTGTGATATCTCCT
GTAGCCTCGCATTCTTTGGTGTTGTTGTTTGGCTACGACGGAAAGAGAAGGAAGCTGTAAACCGCATTGCCCAGAACCAAATCAAGGCTCTGGACTACAC
CGTGCAACTCGTGAATTTGCCGCACCATGACGATCTCAATCTGCTTCGACAAGAGGTGAGTCCACCATTATTCGAGGTGCTGGATGCACCAAAGCGTCGT
TCATTCTAACGCTAGTTCGGTCTGACTAGATCCGACTACATCTTGAAGCAGTCCTAAGTAACGCGCCACCATTCGCGGTGGAGCTTGATCGTGTGCGTGT
TGCGGACGTCCAATTCGGCAAAAGCGCGTCTCGCCACTTGCGTTTACTCGGTCGTCGTGGAGCTATCGTACGACACCTCGAAATTGCACAGCAGCGTCAT
GAAAAGCTAAAGCTGTTGAGTGGGCGACTGGATGAGCGCGTTTACGCCAGACGCGAGAAGCGACACTTAAAGGCTATCCACAAGCTAGAGACGAAGCTGC
ACGGCTTCAACGTCAAACTGGAGCGGTGGCATGCTCGTCAAAAACAACGAAATATCTCTCAAGCTGTCACGGCTTTCGTGACATTTGAAGAAGAGGAGGG
CGCCCACCGCTGCCTGCAAGAGTACCCGGATCTGGGATGGTTCCACCGTCTTTTTCAACCGTACTACAAGCGTCTTCATGGCAAACGACTTCGCTTTCGC
CCAGCCCCAGATCCGACCGACATCATTTGGGAAAACCTGCATCACCCGTTCTTTGAGCGTGTCTTTCGACAACTGGTACGCTTTTAAAAACCTTGGTACG
AGTATCTCATCGTCTAACGTGCGTTCTCCATATGCTGTCCGGCAGATTGTTGCGTTGATCACGCTCGCAGTGTTGTTTGTGAGCTTCTTACTGATCTTCG
CGGCAAAGGAGCAGAAGACCAAACTCGAAAGGCAGTTCGGCCGACCATCAAGCTGTCCTGTTGATGTTTTGAAAACCGACGTCATTCAAGACGAGCAAAA
CAAAGTTTCAGGGCTCATGCCGTACAAGGCGCTCGTTGAATGCTACTGCAAGAACTTCCTCACCTCTCAGTAAGTTCATCACAGTTTGCAAGCCTTCCAT
TCTCAAACTGTGTGCTCATGATCAGACTTTAACTTTGTGCTTCGCTTGTTGCTATTACTCAGCTCATTCCGCAGCATGATGTACGAAAGCTTTTACAACT
CAGAAACTGGAGAAGATGAAATGCTCTGTCGGACTTGGGCCACAACATTTGTGACGACCCAAGTGCTGTCCATTGCCTCGGTGCTGCTAGTTGTAGCTGT
GAACCTCATTTTGGCTCGCATTCTCAATGGTCTGGTCGCTATGGAGAAGCATCACACGCAATCGAGCCTTGTGGTGTCACGAGTCACCAAAGTCTTCATC
GCGCAATTCTGCAACACCGCGCTGTTGATGCTTGCCATCAATGCGAATGGCAAGTATTTTTCAGCTTCACCGACAAGCATGAGTACCACCGGAGGCTTCT
CAATTGGTGCACTACAGGTGTTGAATGGCGAGTATTCAGACTTTTCAGCGGAATGGTACAACGACGTCGGTGTGGCGCTCATGCTCACCATGATCATCAA
TTCGTTCAGCATGCACGCGTATCTCTTAGTCCAATACATCGTGCTCAAAGCTCGCCGCTTCATCGATCGAGGATACTCTTTCAACCACTCCCTCACCAAA
CAAGACACACAGCGTGATCTTGAGACACTATATCGTGGACCCAAGTTTGATCTCGCTGCACGCTATGCCCAATCGCTCACCTCGATCTTCATCATGTACA
TGGTAAGTCTGAATTGACCTCACATTGTCCCCACGCTGCAAAACTAATCTAGGGTTGCAGTTCTCGGCAGGAATGCCTCTGCTTCATTTCATCGGATTTG
GGGCTATGATCATGACGTACTGGGCCGACAAATTCAGTAAGCTGTCATGGTAGCGAAGACTTTATATCGTCCAGTGACTCACGTTTTCCAATGATCGTTG
CAGCATTTCTCCGTATCGCTCGGTCGCCACCTTTGTACGATGGTCAGGTTGCCACTGCGGCAGGATCTCTGCTTCCTTATGCAGTGCTGATGCACTGCCT
CATTGCCATGTGGATGTTTTCAAACGACCGCATATTTGAGTCGGAAAGTGACGTGTCCAAGGAGGATTCCTCGGTCAACACACCATCAGCCCCGGTGATG
GCATCCCATTATTTGACGCAGCTTATCGAGGTCAGTTAATCTCCCGCGTCACCCGCCCGCAGGTCGTCGTCCTTTTCGCCTTCTTCGTGGCTGGCTGCAC
TATCGTGGTAATGCGCACCGTGGTCTTTGAATATGTGCCGGCGCTAGTACGCAGCGTTTTGCCAGCACTTGCTCGATTACTGGAAAATCCCCGTGTTGCG
AAGGGCATCCCTAACTACTTCGATGGTACGTGTGCTTCTTCGAACTGTTCATGACAACCTCTGATTGACTTTTCATGCTTTTAGCCATTCCGACGCCTTG
TCTGCAAGAGAAATTGGCTGCCACGGGCGGTACGCAACAACTTCTGCGGCCGGACCTGCGCGCCAAGTACGAGCGTGCTCTGGTTAGCCGGGTCGCACAG
GAGGAAGTTCTGTCAAAAAAGCGCTCGGTGCGTTCCATGTCAGCGACTGAGCGCTTCAACCAGGTAAACTGGATCGTCGGCTGTCATTCCTATGGTAAGT
CGCTCTTTTATCGCCATCAGCAAGCAGCAACCCTGACCAGTGCTTGTTTCATTCCAGCTATCAGCGACAACAGGGAGTACGTCGCGAAACTTGCCATCGA
CTCGCACCTCTCGGAGGAAATTCCACTCGATCAGATTTTCTAGGACGCAGGAACAACTCTGCCCTAGGTGGTATGGTACACGCGCTGGGCGTTTATTAGC
GGCTTATTTCGTGAAAAAAACTCAACTTTCCCTACTCTCTTCGTCTTGTCGGCCCTTACACGCGGCATCTTGAACACATTTATGCCAGGCAGACTATTCC
AAGGCCTTGGGAGATGGAGAGGAGCCGTCTGCAGTTGACGACGATGGCGATTGCACACGCAGGCCAACGTCTGAAAGGTCAGACCTCTGTCCTGCGCGAG
TCTGAGATCGCGTATTGTTGCTTTGGTAGAAGCCCATCGCCATCTCGGTCTCGCCAGGGCAGTGCGAGAATGCAAAGCCGGTGTTGCGGCGAACGAGTCG
CGGTGAGTCCATCACCACAGCAGCGTCTTCCCCCTTAGCCAAACGATTCCACTCGCGCATCAGATGTGATGGCTCGGGGTAAAATAATACTCGCCCAGCC
TTGGCGATATAGTTCGGTAGAATGGCGATAACCACAGACAGCAAGAGGCCAAGCCAGAACCACGGCTCGCGAATAAGCTGGTCTACCACTCCATAGCCCA
CTTCCGTGTCGTAGAAATCAGCATTGGTCCATCCGAACACAGCACAGAAGAATGCCGTGAACAGGTAGTAAAACACCAGCGTGCCGACAGTTGCCAGAGC
GTTCGTCCGTGTCCAATTGCTCGTCATGAGCGCCACTTGCGCCGTCGAGGCGGTGATCAGGTACGTGTATGACGCCACACCATTTGCCCAAAGGCCTAGG
TCGCGCTTGTCAAACTGAAGCTTTGATGAGTCACTCGAAAAGTACCAGACGATGGAGCCGTTCGAAAAGAATGGCACCGCGTACACCACGTAAGCATGCC
ACGCGCCCAATATGCACCAGCCAAAGAAAGTCAGCCAGTTGAACGAACGATTCTTCAGGCCGTTCACGTACAGCGTCGGGTACTGCATCAGCACTGCAGG
AGACACGTCCTGGTTGTACATGGCAATAATCACGATCGGAATCGTCGTAAACAGAGCGTTGTAAAGCGTAAAGAAGATGCTGAAGTACATCAGCAAACCA
CTGTACATCGTCTCCATCGCCAAGAAGAAGTTAGACATCGACAGCGCCACGTTCTTCATGAACGAGAACAAGATCAACTTGGAAATTCTCTTGTAGCTGT
AGTTGCCGTGCACCAAAAGAAGGCGCTTCAGGAAGTGAAACTCCGCGATAGAATAGTCACTGGAAAGAACGGCTTGGCGGCCCTCTTTACCACTGATACC
GACACCCACATTCGCGGCTTGAATCATCGGCACATCATTTGCGCCGTCGCCGATAGCAAGCGTAATGTTGCCAGGTGAGAACATAAGCGTGGGTTCCGTA
ACCAACTTCACCACTGACGCCTTCTGGGCGGGCGAGCAGCGGCAGCAAATCACAGATTTACATTGCGTGGCCACTGCCAAGAAGAGGTATTTGATGTCAT
CATCCAGCACCAGCGCCAACGTTTTGCCATCAATAACCATAGCAAACTCCAGTTCCTCGTCGACGTAGTCACCGCTGCTCATGCTGCCAGTACCACCCGT
CATCGTATCAGTTTTAGGCTCGAAATCGTGGTCGCACAAACCACGTTCGAAGCTGTTTTCGGAAATGTCACGGTTCGGCAGCGCAGGATACACTTCATCG
AAATGGACAGGGCTGTCCGTCGGTGTCGTATCATGTTCGCGTCGTGGCAAGCGTCTCCTCTTCTTTCGGGCCTCTGCTTCTTCGTCGCGTCCCACAAGTG
CCAGTTTTACAAGATCCCACAGATACAGAATCGCTCGCTTCAACGCTTCCCACAACACACTGAACGCCGACGAGGTCTCATCTGATCCCCATTTGTCTTC
AACAAGGTCGACGTACAGTTCTTCCAGCCGAGTACGAAGCGAGCCCTTGTCGCGCTGGCCCAGTACAATCACATCCATATTATCATCGATCACGTGTGAC
GACATGCCAATGCTGAGCGCTGTTTCCTTCTTGTCACCCGTGAGCACCCAGAACTTAATACCAGCCTTGCGCAAAGCACAAATAGATTCTTCCACACCGT
CCTGCAGTCGGTCTTCGATGGCTGTCGCACCGAGCAGTGTCAACTCAACCTCAATGATAGCCGAAACCTTGGCAATTTTTGCGGCACGTCCCTCCATCGA
AATTCAGCCTGTCGGTATAGGCTGCTCCACTGTTCATACTCCTCTTGGGTAAGGCGACGCATTGCAGTGGTAAGAGTTCGAAGGCCTTCCGACGCGTACT
CCTGAAGATGACCACGCGTCACATGCGCCACACCCTGTGGCTGGGTCTTGGAAAGGAGATCGAAAATGACGTCGTCTGCACCCTTGCAGTAGAGCACAAT
ACTACCATCGGGAAATCGTACAACCACTGACATTCGTTTCCGATCGCTGTTGAACTCTAGCACGTTCAAAATCTCAAACGACATCAGTCTTCCTTGAATG
AGAGCATTGCAAATCGGACCGTCGCGTGATTCAAGAACGTAGCCGAGGTCACTCGCAGCCTGTACAAGTGCCTCCTCGTCAGGGGAAGACGCATTGTATT
TGATAGTTGCTGTCGGCGCCGAACAGGAGTCGCCAGTGGATGTAGGCGATGCGGGAACATTGGTCTCGGGTATCACGGTGTTGCAAATGGTAAGCAGTAG
TAGGAAATCGTGGATCTCCTTCTTTGTCGAGTGGTTCGAATTGAGACGCGCCATCAAGCGGTTATCATTGAACCGAGTTCCAGGTCGCGTGGGCTTTGCA
GGGTCTACTTCGATGTCATTGTAGCGCAGACCAGCCACAGTACACTTCGCAAAGATCATTTCGTTGCAAGTGAGTGTGCCTGTCTTGTCCGAGAATATAT
ACTGAATCTGGCCAAGATCTTCGTTGATGTTGCTGTTGCGAACCTGAGCTGGCGTATCTGTCTTGGTGTCGTACATCTCGAGATCGTTTTCAATGTAACG
TGCGTGAACAAAACGCACGCCTTCCATCGTCACGTACATGGAGAGCGGGATCAAATTGTTGAACAGGATCACGTAACTCAAAAAGATGTAACCGTTTGAG
TCTTCCTCGATGTACCAGGGCGTTGTCTCGTCAGCCAGGTCAAGGTTCCAGTTGTTGTTGCCCAACGTGCAAGCAATTGAAATTCCAAACAGTAACATGA
GCACCAGAACGAACATGGTGTCCAGGGTCTTCTCCACAAAGCTTCGCTTGAGAGGCACAGCCGTGGAGTTCATCTGGACCTTCGTCTCCTTGCCCGTGTA
AATCACGAGTCCCAACGTCCATTCAGAGTTGCGGCTCTCACTGCCACGCAGAAGCAAGTTGTCCATGGTCAAACTTGATTCGTTGTCGTCGTTGTTGGCA
TCTGCAACCGCATCGTCTGCTATCTTTCCAAGTCTCAGCACGCCGTCGAAATAGAACAGGTCCTTGTTGGGCACGTCGCACTCCACCTGGAGTTTGTACT
TCTCCAGAATCTCCTCTGCAGTCATAAAGTGCTTCGTGCAGCTGGCTACCTGGCGGATCTTCAGGTTAGTTTCGCCATCCAAGTTGGCCGTCTCAACGTA
GCATCGGCCGTCGGGTCGACTTGTCGCCAGCAAAATGCAGTCAGCCGGAACCTGATCGCCGTCCTTCAACATCAGTACATCTCCCACTTCGATATCCTGC
CAAGTGCCATCGATGTGCATCACCTCATTCACAACGTCGCGGCGAATAATGTGCGCCGGCCTGGAATTTACCATGGCGTCTCCCTTTTGGCGACGCAGGT
CTTCGCTCACGTCCTTGAGTGCAGACGTCGCGAACACGATCAGCAATGGCGTCAGACTAGCCACGGGACTCACTGGCGAAAAGTCGAAGAAACACAGCGC
CACCACGATGGTCGTATAAAAGTTGGCGAGTCGGCTGAACTGCATCTTGAGGAACACGAACAGGAAGTTGTAGTACGTGTACTTGCTCGTAACGATGAGG
TTGGAGGAGAAGACAGGGCCTCTTCCTGGGCTTCTGCCTCCTTCCTGCGCTGCTTCTTGGTCTTCAACGCGTCGGGCAACGTCATCGACACACCCGACTG
ACTGCGTCGCAACCTGTTGTTGGGGATGCCCGGGCCCACCACAATCTTCCGTCTGGCTGACGGACCTTCATCCTCGTCCATCTCATGGGTCGACGGGTTG
ATGGACAGCGTCTGATGCAGCGAGTTGGCCCGCAGCGGGGACGGCATCATCGTGGCGAGAGCTGCGCGGTCGCACTCTCGCTGGTTCTGCACGGCCTTGA
CGATGCGGCGGAGTTTCCAGCCGTACATGAAACCCGTGATGTTGAGCATGGTGAGCAAGATGGAGAAGAAGCCCTGCATAAGCACGGACGTGCCGCTGCT
GACACTATTGAGCTTGCCATTGTAGCCCTTGTAGTACCAGATGACGTCCACCAACAGCGTGAGTTGCATGCCGATCTTGTAGCTGAGCAGGAACTTGGGC
ACGAGGAACTTGGTGCCATGCCAGCCCAGCACGAGCGTCACGTACAGGATGAGCACGGGCACCGTGGCCTGAAAGCTCAGGCCCAAGATAATGGGGAAAA
TACGCAGCGAGTTGATGACCGTCTGCGACACGATCGTGAACTTGAGGCGGCGCCGCGTCTGGTAGATTGTCATGCCCTTGAGGAAGCAGAAAACCTTCTC
GAAGAGGTTCCACACCTTGGTCTCGGCGTTGGGCTTGGAATCAGACGCCACCGAGTCCGCCATACTGTCAAATGTCAACAACAAAAAAGGCGTCAGAAAT
GATTAGTTCACGTGTCAAAATTGTCTTTTTTTCCATTTTCCCGTCGAACAAGTCGATGTGCTTGTTTTTAGGGACGAAGGGTGTTGTGGGATTAAGCACG
GTACCTATCGGCACGATACCGCAGCGAGATGATGTTGCGCTGCTCCTCCTCGTTCGGGACGCCCGTGAACGTGTTGATGCGCCGCAAATTCTTGTGGGCG
TGTGACTGCGACGTCGGCGGCGGCTGCGCGCCGTCAGCGGAGGAAGGTGCTGTCTGGCCCATGTCCAGCGTGTACTCTGTGGAGCTGTCGGACGGCGAGG
GCACCGCGAACTCGACGCGCATCTTCAGTCCGTTGCGAAGCCGCTTGGAGCCTATTCTTGAGCCGC