Description :
From Genome Similarity Track
Location :
Scaffold_197:24359- 25761
Sequence
1402 bases(100 bases per row)
GTTGTTCGTTGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTC
CCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCGGACAGAGCGCGTCAATCGAGTGCTCGAGGACACCCTGCGCA
GTGTATGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGCTGTTGCGTTTGCGCTCAACAACGCAGTGCACGCGTCCACGGGGCTCACGCTGTT
CTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACACCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCC
TCCCAGGTCTCGGATGTGAGACCTGTTTCGCTGCGGAACCAAGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCTATGG
CAGCGGCCCAAGATAAACAAAAGGAGTACTCCGACAAACATAGAAGAGGAAACTTAAGTATATTTAAGGTGGGGGACTTAGTGTTGCTAGACACGAGGAA
CCTACCCCTTGACACTGTCAGCTCTGTCGGTAGCAACAAGCTGAAGCCCCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACC
ATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGGCGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGTAGACCCACC
TTGACACAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGAACGGCAAGGCTGCGGTCAAGA
CCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGAGTCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGCG
TCGAAGGCGGATCCGGACGTGGCAACAGACGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGATGCCCGGAGATCCACCCGCAGATGC
AGGCTCGCGAACTCTCGCTTCAACAGGTCCAGGGGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTTCCAA
GGCCAAGTGCAATATCCAGCATGAGGACACGCTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGCCGGAGCACTCGGACGAGAGTGGCT
CTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGTCACCTCCGACCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGA
GC