Description :
From Genome Similarity Track
Location :
Scaffold_214:24359- 25649
Transcript NameFunction/comments
g13813.t1ETI41140.1 hypothetical protein F443_13609 [Phytophthora parasitica P1569

Sequence
1290 bases(100 bases per row)
CGACGGCATCCCACCCGAGATCTGGGAAGATATGGTCAAGCACGAGAAGTTCATCTACTTCTCGCTCATGTTCCTCAACGGGTCCGTGCTCTGGGCCTAC
TACTCGTGCCTGAGCGCCCAGGACTTTTACACCGTCGAGTTCCCGGACTCCGGACTCGATTTTTCCTTCCTCACGACGCTGTGCACGGCCTGGCCCATGG
TCTTCGGCCAAGGACTGCAAATGATCTTCGGGCTGGACAAGAAGTTCAGCCAACGAACGCGCGTGCACGTGGGCTACGGCATCTTCATGGCCATGGCCAT
CCTTATCATGGTCTTCAGTGCCATCGACTTCTCCAGTCAAAAGACCGGCGGGGTGCTCGTGCTCGTGTGCTTTGGGTGTATCGGCTTCGGCAACTCGCTG
TCCGAAGCCACGTATTACACGTTCGCGGCGCTCTTCCCAATCGAGAAGTTCACAAACGGCGTGCAGATCGGCAACACCTGCGCCGGCATCCTCAACATCA
CCGTGGCCACGGTGCTGCGTCTTGCGGTGGGAGGCGTGAACCAGACCAGCAGCTCCACAAAGCTGAGCTTTTATCTGTTCTTTAGTTTGCTGGTGGTTGT
CCTGATATGCGCCATCCTGCTCTACCGCTACTTGGTGAGTCTGCCGTCGGTCAAGTTCCTCATGGACCGCAACGAGAACTCGGCCAAGGACGAGCACCTT
GCGCACCAGTCGGTCGGCCGCACGCTGAAGAACTTGAGCCGCATCTTCTACATCATTTGGGTGCCGGCGATCGCGCAGTTCCTTGTCTTCTTCGTGTCTC
TCTCGGTGTTCCCGGGCTTCGGCTGCGCGGGGTCTCGCAATTTGGCCCCGCCGTTCAACGATGAAGCTCACGTCCTCACGGCGACATGGTACTGCTCGCC
TGGGATCATCGGCAGCTACAACTACGGCGACTTCATCGGTCGGATCCTGTGTACGGCTGCAGTGTACCGCGTGGTGACTATGGGCTGGGCGTTCGGCTTG
TCGGTGCTGCGTATCGCCTTCATCCCGCTGCTACTAATGGGCGTGGCCGGCACTTCGCTCTACGCGTTCCCGTTCGGCAGTATGGGGGCGCTGGCCTTCA
ACATCGTGCTCAATCTACTCATCGGCATTTCCACGGGTCTGCTCTCGACCGTCACCATGGGCGTGGCGCCTCGGATGTTGAAGCCCGAGGACCGCGAATC
CGGTGGCGCCGTTATGGTGTTTTTCCTCTTCCTAGGGATCGCCACGGGCTCCACCTTTGGGTTCCTCGTGAGCGACAACGGTTGGCTCGG